ID: 937162227

View in Genome Browser
Species Human (GRCh38)
Location 2:119775328-119775350
Sequence CTGGACAATAACTCTTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937162223_937162227 6 Left 937162223 2:119775299-119775321 CCAGTCTATTGGTCATATAACAA No data
Right 937162227 2:119775328-119775350 CTGGACAATAACTCTTTTTCTGG No data
937162222_937162227 13 Left 937162222 2:119775292-119775314 CCAGCTGCCAGTCTATTGGTCAT No data
Right 937162227 2:119775328-119775350 CTGGACAATAACTCTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937162227 Original CRISPR CTGGACAATAACTCTTTTTC TGG Intronic
No off target data available for this crispr