ID: 937162481

View in Genome Browser
Species Human (GRCh38)
Location 2:119777792-119777814
Sequence GGCATGGTGGAACACACCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937162481_937162487 17 Left 937162481 2:119777792-119777814 CCATAGGTGTGTTCCACCATGCC No data
Right 937162487 2:119777832-119777854 TCCCCTAAGAGATGAGGTCTTGG No data
937162481_937162491 30 Left 937162481 2:119777792-119777814 CCATAGGTGTGTTCCACCATGCC No data
Right 937162491 2:119777845-119777867 GAGGTCTTGGCATATTGCCCAGG No data
937162481_937162486 11 Left 937162481 2:119777792-119777814 CCATAGGTGTGTTCCACCATGCC No data
Right 937162486 2:119777826-119777848 TTTTTTTCCCCTAAGAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937162481 Original CRISPR GGCATGGTGGAACACACCTA TGG (reversed) Intronic