ID: 937162486

View in Genome Browser
Species Human (GRCh38)
Location 2:119777826-119777848
Sequence TTTTTTTCCCCTAAGAGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937162480_937162486 25 Left 937162480 2:119777778-119777800 CCTAGTAGCTGGGACCATAGGTG No data
Right 937162486 2:119777826-119777848 TTTTTTTCCCCTAAGAGATGAGG No data
937162483_937162486 -5 Left 937162483 2:119777808-119777830 CCATGCCCAGCTAATTTTTTTTT No data
Right 937162486 2:119777826-119777848 TTTTTTTCCCCTAAGAGATGAGG No data
937162477_937162486 29 Left 937162477 2:119777774-119777796 CCTCCCTAGTAGCTGGGACCATA No data
Right 937162486 2:119777826-119777848 TTTTTTTCCCCTAAGAGATGAGG No data
937162479_937162486 26 Left 937162479 2:119777777-119777799 CCCTAGTAGCTGGGACCATAGGT No data
Right 937162486 2:119777826-119777848 TTTTTTTCCCCTAAGAGATGAGG No data
937162481_937162486 11 Left 937162481 2:119777792-119777814 CCATAGGTGTGTTCCACCATGCC No data
Right 937162486 2:119777826-119777848 TTTTTTTCCCCTAAGAGATGAGG No data
937162484_937162486 -10 Left 937162484 2:119777813-119777835 CCCAGCTAATTTTTTTTTTTCCC No data
Right 937162486 2:119777826-119777848 TTTTTTTCCCCTAAGAGATGAGG No data
937162482_937162486 -2 Left 937162482 2:119777805-119777827 CCACCATGCCCAGCTAATTTTTT No data
Right 937162486 2:119777826-119777848 TTTTTTTCCCCTAAGAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937162486 Original CRISPR TTTTTTTCCCCTAAGAGATG AGG Intronic