ID: 937162491

View in Genome Browser
Species Human (GRCh38)
Location 2:119777845-119777867
Sequence GAGGTCTTGGCATATTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937162485_937162491 8 Left 937162485 2:119777814-119777836 CCAGCTAATTTTTTTTTTTCCCC No data
Right 937162491 2:119777845-119777867 GAGGTCTTGGCATATTGCCCAGG No data
937162481_937162491 30 Left 937162481 2:119777792-119777814 CCATAGGTGTGTTCCACCATGCC No data
Right 937162491 2:119777845-119777867 GAGGTCTTGGCATATTGCCCAGG No data
937162483_937162491 14 Left 937162483 2:119777808-119777830 CCATGCCCAGCTAATTTTTTTTT No data
Right 937162491 2:119777845-119777867 GAGGTCTTGGCATATTGCCCAGG No data
937162482_937162491 17 Left 937162482 2:119777805-119777827 CCACCATGCCCAGCTAATTTTTT No data
Right 937162491 2:119777845-119777867 GAGGTCTTGGCATATTGCCCAGG No data
937162484_937162491 9 Left 937162484 2:119777813-119777835 CCCAGCTAATTTTTTTTTTTCCC No data
Right 937162491 2:119777845-119777867 GAGGTCTTGGCATATTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937162491 Original CRISPR GAGGTCTTGGCATATTGCCC AGG Intronic