ID: 937163910

View in Genome Browser
Species Human (GRCh38)
Location 2:119794394-119794416
Sequence GAGCCAGATGTGGAGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937163905_937163910 -5 Left 937163905 2:119794376-119794398 CCCACACCTGCCAAGGGTGAGCC 0: 28
1: 82
2: 154
3: 193
4: 374
Right 937163910 2:119794394-119794416 GAGCCAGATGTGGAGCAGCAAGG No data
937163901_937163910 6 Left 937163901 2:119794365-119794387 CCAGCCTGGATCCCACACCTGCC 0: 27
1: 58
2: 118
3: 185
4: 677
Right 937163910 2:119794394-119794416 GAGCCAGATGTGGAGCAGCAAGG No data
937163899_937163910 13 Left 937163899 2:119794358-119794380 CCCGCTACCAGCCTGGATCCCAC No data
Right 937163910 2:119794394-119794416 GAGCCAGATGTGGAGCAGCAAGG No data
937163900_937163910 12 Left 937163900 2:119794359-119794381 CCGCTACCAGCCTGGATCCCACA No data
Right 937163910 2:119794394-119794416 GAGCCAGATGTGGAGCAGCAAGG No data
937163906_937163910 -6 Left 937163906 2:119794377-119794399 CCACACCTGCCAAGGGTGAGCCA 0: 33
1: 81
2: 171
3: 220
4: 456
Right 937163910 2:119794394-119794416 GAGCCAGATGTGGAGCAGCAAGG No data
937163902_937163910 2 Left 937163902 2:119794369-119794391 CCTGGATCCCACACCTGCCAAGG 0: 56
1: 122
2: 216
3: 264
4: 453
Right 937163910 2:119794394-119794416 GAGCCAGATGTGGAGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937163910 Original CRISPR GAGCCAGATGTGGAGCAGCA AGG Intronic
No off target data available for this crispr