ID: 937165890

View in Genome Browser
Species Human (GRCh38)
Location 2:119816753-119816775
Sequence AAACACTGCTTCATAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937165887_937165890 20 Left 937165887 2:119816710-119816732 CCAGTCTACTCCATAATCTCATT No data
Right 937165890 2:119816753-119816775 AAACACTGCTTCATAAAGATAGG No data
937165889_937165890 10 Left 937165889 2:119816720-119816742 CCATAATCTCATTTTGGTTGCTG 0: 9
1: 11
2: 20
3: 22
4: 193
Right 937165890 2:119816753-119816775 AAACACTGCTTCATAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937165890 Original CRISPR AAACACTGCTTCATAAAGAT AGG Intronic
No off target data available for this crispr