ID: 937169898

View in Genome Browser
Species Human (GRCh38)
Location 2:119855501-119855523
Sequence GCCCCTATTATATGTAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937169898_937169903 7 Left 937169898 2:119855501-119855523 CCTTCTTTACATATAATAGGGGC No data
Right 937169903 2:119855531-119855553 GGATAAGGATATCCGTCTTTAGG No data
937169898_937169901 -8 Left 937169898 2:119855501-119855523 CCTTCTTTACATATAATAGGGGC No data
Right 937169901 2:119855516-119855538 ATAGGGGCATCCTTGGGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937169898 Original CRISPR GCCCCTATTATATGTAAAGA AGG (reversed) Intronic
No off target data available for this crispr