ID: 937176061

View in Genome Browser
Species Human (GRCh38)
Location 2:119936399-119936421
Sequence CTGGTCCTGCCCTTGACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2968
Summary {0: 3, 1: 120, 2: 389, 3: 760, 4: 1696}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937176061_937176068 1 Left 937176061 2:119936399-119936421 CCAGGTGTCAAGGGCAGGACCAG 0: 3
1: 120
2: 389
3: 760
4: 1696
Right 937176068 2:119936423-119936445 TAAAGGTAGTTGAATCATGGGGG No data
937176061_937176066 -1 Left 937176061 2:119936399-119936421 CCAGGTGTCAAGGGCAGGACCAG 0: 3
1: 120
2: 389
3: 760
4: 1696
Right 937176066 2:119936421-119936443 GGTAAAGGTAGTTGAATCATGGG No data
937176061_937176067 0 Left 937176061 2:119936399-119936421 CCAGGTGTCAAGGGCAGGACCAG 0: 3
1: 120
2: 389
3: 760
4: 1696
Right 937176067 2:119936422-119936444 GTAAAGGTAGTTGAATCATGGGG No data
937176061_937176065 -2 Left 937176061 2:119936399-119936421 CCAGGTGTCAAGGGCAGGACCAG 0: 3
1: 120
2: 389
3: 760
4: 1696
Right 937176065 2:119936420-119936442 AGGTAAAGGTAGTTGAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937176061 Original CRISPR CTGGTCCTGCCCTTGACACC TGG (reversed) Intronic
Too many off-targets to display for this crispr