ID: 937177435

View in Genome Browser
Species Human (GRCh38)
Location 2:119954383-119954405
Sequence GTTATCTGGACCCAGAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937177435_937177440 3 Left 937177435 2:119954383-119954405 CCTCAGTTCTGGGTCCAGATAAC No data
Right 937177440 2:119954409-119954431 GAGCCTCTCCAGATCTTCATGGG No data
937177435_937177439 2 Left 937177435 2:119954383-119954405 CCTCAGTTCTGGGTCCAGATAAC No data
Right 937177439 2:119954408-119954430 TGAGCCTCTCCAGATCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937177435 Original CRISPR GTTATCTGGACCCAGAACTG AGG (reversed) Intronic