ID: 937178105

View in Genome Browser
Species Human (GRCh38)
Location 2:119962735-119962757
Sequence TAACCAAGAGGTAAGAAGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937178100_937178105 5 Left 937178100 2:119962707-119962729 CCTATATCTTCAGGAAGATGACC 0: 1
1: 0
2: 1
3: 8
4: 118
Right 937178105 2:119962735-119962757 TAACCAAGAGGTAAGAAGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 242
937178098_937178105 28 Left 937178098 2:119962684-119962706 CCACTCTGAAGAAGGAAACACTG 0: 1
1: 0
2: 0
3: 25
4: 310
Right 937178105 2:119962735-119962757 TAACCAAGAGGTAAGAAGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937178105 Original CRISPR TAACCAAGAGGTAAGAAGGC AGG Exonic
902821016 1:18943560-18943582 TAACCCAGAGATAAGGAGACAGG + Intronic
903150327 1:21403489-21403511 TATAAAAGAGGTCAGAAGGCTGG - Intergenic
903537794 1:24078527-24078549 GCACCCAGAGGAAAGAAGGCAGG - Intronic
906800716 1:48734624-48734646 TAAGCAGCAGGTATGAAGGCTGG - Intronic
907752782 1:57279476-57279498 TATCCAAGAGGAATGAAAGCAGG + Intronic
907819985 1:57957758-57957780 GAAACCAGAGGTAGGAAGGCAGG + Intronic
909797659 1:79763150-79763172 TAAGAGAGAGGAAAGAAGGCTGG + Intergenic
909919675 1:81365472-81365494 TAACCATGATGTAAGGAGGCAGG - Intronic
912739504 1:112180889-112180911 TAAGCAAGAGGGAAGAAGTGTGG - Intergenic
914685534 1:149975664-149975686 TCACCAAGAGGTGACAAGTCAGG + Intronic
914790716 1:150875649-150875671 TAACATAGAGGAAAGAGGGCTGG + Intronic
915033147 1:152901414-152901436 CAACCAATAGGAAAGAAGGTAGG + Intergenic
915120913 1:153629115-153629137 AAACAAAGAGGTAAGAATGGGGG - Intronic
915139648 1:153759315-153759337 TAACCAAGAGGACAGAGGACAGG - Intronic
915324314 1:155072832-155072854 GGACCAAGAGAAAAGAAGGCAGG + Intergenic
917240240 1:172940303-172940325 TAGCCAAGGGGTAAAATGGCTGG + Intergenic
920124261 1:203681157-203681179 TTACAAAGAGTTAAGAAAGCAGG - Intronic
921098990 1:211912031-211912053 TAACCAAGAGATGAGAGGGGTGG - Intergenic
921189184 1:212694855-212694877 TTTCCTAGAAGTAAGAAGGCTGG - Intronic
921626849 1:217386591-217386613 CAAGCAAGAGGTGAGAGGGCTGG - Intergenic
922261027 1:223946462-223946484 TAAAAAAGAGGAAAGAAGGCTGG + Intergenic
922736045 1:227979271-227979293 TAAAAAAGAGAAAAGAAGGCTGG - Intergenic
922738916 1:228004996-228005018 AAACCAAGGGGCAAGAGGGCAGG + Intergenic
923065670 1:230515093-230515115 AACCCAGGAGGTTAGAAGGCAGG + Intergenic
923337099 1:232979856-232979878 GAACCAAGAGATAGGGAGGCAGG + Exonic
924096876 1:240561140-240561162 AAACTAAGAGGTAAGGAGACAGG + Intronic
924342196 1:243048635-243048657 TAAAAAAGAGAAAAGAAGGCTGG + Intergenic
924620371 1:245654883-245654905 TAAGCAAGAGGTGAGAATGACGG + Intronic
924746432 1:246838094-246838116 TAAGCAAGGAGTAAGAAGGATGG - Intergenic
1063654636 10:7975577-7975599 TAACTAAGAGGTAAAAGGGTTGG + Intronic
1065984334 10:30934468-30934490 TATACAAGAGGTAAGAAGTTTGG - Intronic
1066734285 10:38456908-38456930 TAAAAAAGAGAAAAGAAGGCTGG - Intergenic
1067105177 10:43361759-43361781 TGCCCAAGAGCTAAGAAGTCTGG + Intergenic
1067749605 10:48962062-48962084 TTAGCAAGAGGTAAGAAGAAGGG + Intronic
1068517719 10:58044829-58044851 GAAAGAAGAGCTAAGAAGGCTGG + Intergenic
1068793216 10:61049562-61049584 AAACCTAGAAGTAACAAGGCTGG - Intergenic
1070539672 10:77407034-77407056 AAAACAATAGGTAAGAGGGCTGG - Intronic
1070553392 10:77509482-77509504 TAACCAAAAGATATGAATGCAGG - Intronic
1072186415 10:93043408-93043430 TAACAAACAGGTAAGAAAACTGG - Intronic
1073022822 10:100460731-100460753 TATCCTAGAGGGGAGAAGGCAGG + Intergenic
1073894107 10:108134207-108134229 AAACAAAGAGGGAAGAAGGAAGG + Intergenic
1074293748 10:112162410-112162432 TGACCCAGAGGTAAGAAGGAAGG + Intronic
1074324407 10:112434472-112434494 TAACAAAGATATAAGATGGCAGG + Intronic
1074646089 10:115454340-115454362 TGACCAAGAAGAAAAAAGGCTGG - Intronic
1075585262 10:123652641-123652663 TGATCAAGAGGGGAGAAGGCTGG + Intergenic
1076157428 10:128214484-128214506 AAAACAATAGGTAAGACGGCAGG + Intergenic
1076303990 10:129450350-129450372 TTACCCAGAGGAAAGTAGGCAGG + Intergenic
1078882281 11:15464075-15464097 TAACCAAAAGGCAACCAGGCAGG - Intergenic
1079280892 11:19085947-19085969 TAACCAAGAGGAAAGATTGAAGG - Intergenic
1080154507 11:29093040-29093062 TAATGAAGAGGTAACAAGGATGG + Intergenic
1080755775 11:35196782-35196804 CAACCAAGAGGCAAGAAACCTGG + Exonic
1080774180 11:35370506-35370528 TCACCAAGAGAAAAGAAGACTGG + Intronic
1083344294 11:61978759-61978781 GAAGCATGAGGAAAGAAGGCTGG - Intergenic
1084770048 11:71336749-71336771 TTACCAAGACCTAAGGAGGCAGG - Intergenic
1085371084 11:76006033-76006055 AAACCAAGAGATTAGAAGGTTGG - Intronic
1085435884 11:76501257-76501279 TAACAAAGACATAAGGAGGCAGG + Intronic
1088505206 11:110520774-110520796 TACCCATGAGATGAGAAGGCTGG - Intergenic
1088891679 11:114049593-114049615 TAATCAACAGGGAAGAAGGTTGG + Intergenic
1090648645 11:128787264-128787286 TCACCATGAGATGAGAAGGCTGG + Intronic
1090911064 11:131120086-131120108 TAACAAAAAGGTAGGAAGGGTGG - Intergenic
1090930710 11:131295791-131295813 TAGCCAAGAGGTAGGGAGGGAGG - Intergenic
1091709875 12:2732219-2732241 TCTCCAAGAGTTTAGAAGGCAGG + Intergenic
1092977720 12:13761778-13761800 TAAACACAAGGGAAGAAGGCAGG + Intronic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1101921492 12:108936775-108936797 TATTTAAGAGATAAGAAGGCTGG - Intronic
1104091943 12:125524977-125524999 TAGCCAAGTGGAAAGAAGGAAGG + Intronic
1104390353 12:128386520-128386542 TAACTCAGGGGCAAGAAGGCTGG + Intronic
1104612718 12:130242704-130242726 TAGCCAAGAGGAAAGCAGGAGGG - Intergenic
1105858284 13:24389873-24389895 TAACCAAGAGGTTCATAGGCAGG - Intergenic
1107912305 13:45116791-45116813 TAACCAATAGGTAATGAGTCTGG + Intergenic
1108697307 13:52913777-52913799 TGGCCAAGAGGTAAGAAGTGGGG + Intergenic
1112197617 13:97241317-97241339 CAACCAAGAGGAAAGAAGTGTGG + Intronic
1113497998 13:110748516-110748538 TAACCCAGAGTCAAGAAGCCCGG - Intergenic
1113920845 13:113908442-113908464 TAACCAAGAGAGAAGAAAGGTGG - Intergenic
1114297665 14:21344476-21344498 TAACCAGGAGATAAGAAATCTGG - Intronic
1114405792 14:22454951-22454973 TGATCAAGAGGAAAGAAGGGTGG - Intergenic
1114576546 14:23719546-23719568 TAGCCAAAGGGTAACAAGGCAGG - Intergenic
1115313366 14:32002180-32002202 TAAACAACACTTAAGAAGGCAGG - Intergenic
1116041347 14:39690017-39690039 TAATCATGGGCTAAGAAGGCTGG + Intergenic
1117729933 14:58712245-58712267 TAACAAAGAGGTAGCAAGGTTGG - Intergenic
1117773071 14:59154168-59154190 AAAAAAAGAGGTGAGAAGGCAGG - Intergenic
1118350679 14:64971282-64971304 AGACCAAGGGGTCAGAAGGCAGG - Intronic
1118689033 14:68320584-68320606 TAACAAAGAGGAAAGCAGGGAGG - Intronic
1118799606 14:69177568-69177590 TAAACTAGAGGAAAGTAGGCCGG + Intergenic
1120635206 14:86942803-86942825 TAACTGAGAGATAAGAATGCAGG - Intergenic
1120949144 14:90024976-90024998 TACCCAAGAGATATGAAGGAGGG - Intronic
1124891844 15:33740925-33740947 TAAGTAAGAGGTAAGAAGCATGG + Intronic
1126150341 15:45518062-45518084 TAACCATGAGGGAAAGAGGCAGG - Intronic
1126228903 15:46302542-46302564 TAACCATGAGGTAATATGGTAGG - Intergenic
1126725600 15:51628477-51628499 TAACCAAGTGGCAACAAGGTAGG - Intergenic
1126924377 15:53566683-53566705 AAACTAAGAGATAAGAAGACAGG + Intronic
1127818349 15:62632612-62632634 TAAACAAGATGGAATAAGGCTGG - Intronic
1128288225 15:66456430-66456452 TCACCAGGAGGTCGGAAGGCAGG + Intronic
1129761891 15:78133776-78133798 TAACCCATGGGAAAGAAGGCAGG + Intronic
1131976707 15:97953991-97954013 AAACCATGACATAAGAAGGCAGG + Intergenic
1135782890 16:25321572-25321594 TAACCAAGATGAAAGGAGGCAGG + Intergenic
1138790471 16:59897984-59898006 TAACCAAGTAGTAAAAAGGTTGG + Intergenic
1139322379 16:66125912-66125934 TAGCCAAAAGGGAAGAAGACAGG - Intergenic
1143784665 17:9247443-9247465 TACCCAGGAGGTTAGAATGCAGG - Intergenic
1144373702 17:14618144-14618166 TGACCAGGAGGTAACAGGGCAGG - Intergenic
1146672740 17:34753008-34753030 TAGCGAAGAGGGAAGGAGGCAGG - Intergenic
1146792143 17:35757467-35757489 TAACCAAGAGGAGACAAGGAAGG + Intronic
1147480085 17:40752480-40752502 CAACCAGGAGGAAAGAAGGCTGG - Intronic
1148444905 17:47731608-47731630 GAACCAAGAGGCAAGTTGGCAGG - Intergenic
1151105764 17:71615153-71615175 TAAGCATGAGGTAACAAGCCAGG + Intergenic
1151918483 17:77136563-77136585 CACCCAAGAGCAAAGAAGGCTGG - Intronic
1152506268 17:80750770-80750792 TAAACAAGAGGGAAGAGGGAAGG - Intronic
1153519379 18:5937680-5937702 TATCCAAGAAGGGAGAAGGCTGG + Intergenic
1154010084 18:10566914-10566936 AAACCAAGATGCAAGATGGCTGG - Intergenic
1155360108 18:24991295-24991317 GAACGTAGAGGTGAGAAGGCTGG + Intergenic
1156922046 18:42533865-42533887 CATCTAAGAGGTAAGAAGGATGG + Intergenic
1158176260 18:54659968-54659990 AAATAAAGAGGTAAAAAGGCAGG + Intergenic
1158528488 18:58236413-58236435 TAACCATGAGGGAAGTAGGTGGG + Intronic
1159137182 18:64350124-64350146 TGTTCAAGAGGGAAGAAGGCTGG - Intergenic
1163046517 19:14646723-14646745 AAACAAAGAGGAAAGAAGGAAGG - Intronic
1163378613 19:16949580-16949602 TAGGCAAGAGGCAAGGAGGCAGG - Intronic
1165128317 19:33616641-33616663 TACCCAGGAGGGAAGAAGGCAGG - Intergenic
1166414926 19:42588494-42588516 TCACCAAGGGGGAAGAAGGAGGG - Intronic
1166845910 19:45728332-45728354 GAACCAAGAGGGAAGATGTCAGG - Intronic
1168461053 19:56558789-56558811 AAACCAAGATGTGAGAAAGCAGG - Intergenic
928282688 2:29963216-29963238 AAACAAAAAGGTAAGAAGGAAGG - Intergenic
929762078 2:44815054-44815076 TCACTAAGAGGGGAGAAGGCAGG + Intergenic
929877875 2:45812046-45812068 GAACCAAGAGTTAAGAAACCTGG + Intronic
932067940 2:68586969-68586991 GCACCAAAAGGTAAGAAGCCAGG + Intronic
932620748 2:73263838-73263860 TGACCAAGAGGTCAGAGAGCTGG + Intronic
934984701 2:98875957-98875979 TGACCAAGAGGAAAGCAAGCAGG - Intronic
935954229 2:108359691-108359713 TAACCAAGAAAAGAGAAGGCCGG + Intergenic
936065590 2:109329694-109329716 GAGCCAAGAAGTAAGAAAGCAGG + Intronic
936628080 2:114170188-114170210 CAATCAAGAGGAAAAAAGGCTGG - Intergenic
937178105 2:119962735-119962757 TAACCAAGAGGTAAGAAGGCAGG + Exonic
938992739 2:136645967-136645989 GAACAAAGGGGAAAGAAGGCAGG + Intergenic
941498760 2:166241888-166241910 CAACTAAGAGTCAAGAAGGCAGG + Intronic
942106046 2:172634728-172634750 TAATCAAGAGATTAGAAGGTAGG - Intergenic
945679401 2:212895448-212895470 TATGCATGTGGTAAGAAGGCAGG - Intergenic
946272507 2:218605997-218606019 TACCCAAGAGGGAAGGAGGTTGG + Intergenic
948875603 2:240825738-240825760 TCAACAAGAGGTCAGCAGGCAGG - Intergenic
949083179 2:242121504-242121526 TAAAAAAGAGAAAAGAAGGCTGG - Intergenic
1168732019 20:92685-92707 TAAAAAAGAGGGAAGATGGCTGG - Intronic
1168784713 20:528299-528321 TAACCAACAGCTAATAAGGTAGG + Intronic
1168998372 20:2148932-2148954 TAACAAAGAGCTAAAAAGGGGGG + Intronic
1169853199 20:10075889-10075911 TACCCAAGAGGTGAGAAGTTGGG - Intergenic
1171382087 20:24741883-24741905 CAACCATGAGGTAAAGAGGCTGG - Intergenic
1172814310 20:37674140-37674162 TCACCCAGAGGATAGAAGGCTGG + Intergenic
1174864211 20:54119937-54119959 TAACAAAAAGGGAGGAAGGCAGG + Intergenic
1175196654 20:57248458-57248480 AAACCAAGAGGTAGGCAGGCAGG + Intronic
1176279773 20:64294112-64294134 TAAAAAAGAGAAAAGAAGGCTGG - Intergenic
1176521412 21:7827285-7827307 AAAGCAAGAGCTAGGAAGGCTGG - Intronic
1176669330 21:9717757-9717779 CAACCAAGCGGTTAGAAGGTTGG - Intergenic
1177109713 21:17010671-17010693 CAACCAAAAGGGAAGAAGGAAGG + Intergenic
1177195761 21:17901846-17901868 CCACCAAGAGGCAAGCAGGCTGG - Intronic
1178655432 21:34457297-34457319 AAAGCAAGAGCTAGGAAGGCTGG - Intergenic
1181660377 22:24342751-24342773 TAACAGAGAGGTAAAAAGACTGG + Intronic
1183007594 22:34916480-34916502 TAACAAAGAGGAAAGGAGGGAGG + Intergenic
1184519915 22:44987295-44987317 TAGCAAAGAGGTGAGAAGGAAGG + Intronic
949309801 3:2684272-2684294 GAAAAAAGAGCTAAGAAGGCAGG + Intronic
951590581 3:24260359-24260381 TCACCAGGAGGCAAGTAGGCTGG + Intronic
954414527 3:50386648-50386670 ACACCAGGAGGTGAGAAGGCTGG - Intronic
955893306 3:63673163-63673185 CAACCAACAGGCAAGAAAGCTGG + Intronic
957885816 3:86286304-86286326 TAACCAAGAGGTAATAAATGCGG - Intergenic
958025650 3:88045835-88045857 TAAGCAGAAGGAAAGAAGGCTGG + Intergenic
958604532 3:96340216-96340238 TTACCAAAAGGTAAAAAGACAGG - Intergenic
959481041 3:106873051-106873073 TAACCATGTGGTAATAAGGTGGG - Intergenic
959702286 3:109309777-109309799 TAAAAATGAGGTAACAAGGCCGG + Intronic
961098266 3:124176071-124176093 TACACAAAAGGTAAAAAGGCAGG - Intronic
961133743 3:124491642-124491664 TGACCAAGAGGGAAGAAAGCAGG + Intronic
962745382 3:138394197-138394219 AAATGAAGAGGTCAGAAGGCAGG - Intronic
970257052 4:14179374-14179396 GAACCAAGAGGTAAAAAGAGAGG - Intergenic
972116256 4:35637996-35638018 AACCCAAGAGCTAAGAAGTCTGG + Intergenic
972802403 4:42490629-42490651 GAAACAAAAGGTGAGAAGGCAGG - Intronic
974101921 4:57426424-57426446 TAAGCAAGAGGTCAGAAAACAGG - Intergenic
974149895 4:57993080-57993102 AAAGAAAGAGGTAAGAAGGAAGG - Intergenic
977172787 4:93783730-93783752 TAAGCAAGAGGGGAGAAGACTGG - Intergenic
978215958 4:106204341-106204363 TGACCAAGATTTAAGAAAGCTGG - Intronic
979260637 4:118639899-118639921 TAAAAAAGAGAAAAGAAGGCTGG - Intergenic
980791606 4:137627935-137627957 TAACCCAGAGGAAACAAGCCTGG - Intergenic
982355035 4:154457176-154457198 TAACCAAAAAGTAAGAAAACAGG + Intronic
985272057 4:188203047-188203069 TATCCAAGAGATCAGAATGCTGG - Intergenic
985405439 4:189633712-189633734 CAACCAAGCGGTTAGAAGGTTGG + Intergenic
985516851 5:350720-350742 TAGCCAAGATGTAAATAGGCGGG - Intronic
985956251 5:3268280-3268302 GAACCAAGGGGTCAGGAGGCAGG - Intergenic
987970142 5:24932186-24932208 TCATCAAGAAGTAAGTAGGCTGG + Intergenic
990160553 5:52935547-52935569 TATCTATGAGGTAAGAAGGTTGG - Intronic
994246036 5:97478027-97478049 TAAGTAAAAGGTAAAAAGGCAGG - Intergenic
995540612 5:113182716-113182738 TCACCAACAGGTATGAAGACTGG - Intronic
995716792 5:115088301-115088323 CCACCAAGAGGTGAGAAAGCTGG - Intergenic
996329866 5:122316534-122316556 GAAGCAAGAGGTAAGAAGGCAGG + Intronic
996597146 5:125218210-125218232 TAGCCAAGGGGGAAGAAAGCAGG + Intergenic
1000019447 5:157306444-157306466 GAACAGAGAGGGAAGAAGGCAGG - Intronic
1000386710 5:160681433-160681455 TGACCTTGAGGTAAGAATGCAGG - Intronic
1002753345 6:141137-141159 TAAAAAAGAGAAAAGAAGGCTGG + Intergenic
1002829311 6:804799-804821 TAACAAAGAAGGAGGAAGGCCGG - Intergenic
1004630166 6:17413382-17413404 TAAGCAAAAGATACGAAGGCGGG + Intronic
1004663169 6:17728132-17728154 AAACCAATAGGTAAAAAGGAAGG + Intergenic
1005019315 6:21402380-21402402 TATCCAAGAGGAGAGAAAGCAGG - Intergenic
1007246195 6:40464823-40464845 TACCCAAAGGGTGAGAAGGCTGG - Intronic
1009978309 6:70697822-70697844 TAACCAAAAGTTAAGAAGTGTGG - Intronic
1011146433 6:84222882-84222904 TAACAAACAGGTAGGAAGACAGG + Intronic
1011586380 6:88930770-88930792 TACCCAAGAGCTAAGGAGTCTGG + Intronic
1012279322 6:97310253-97310275 TAAGCTAGAGATAAGCAGGCAGG - Intergenic
1013419478 6:109952900-109952922 GCACCAAGATGTAAGAAAGCAGG + Intergenic
1015657680 6:135538152-135538174 TTTCCAAGAGGTAAGACAGCTGG - Intergenic
1017364478 6:153618543-153618565 TAACCAGGACACAAGAAGGCAGG + Intergenic
1021266924 7:18536176-18536198 TAACCAAGGGGCAAGGAAGCTGG - Intronic
1021381532 7:19973124-19973146 TTTCCAAGAGTTAAGGAGGCAGG - Intergenic
1023502598 7:40866200-40866222 TCACAAAGAGGTAAGAGGGGTGG - Intergenic
1024340246 7:48250364-48250386 CTACCTAGAGGTTAGAAGGCAGG + Intronic
1024953177 7:54886723-54886745 TCACCAAGAGGAAAGATGACTGG - Intergenic
1025059875 7:55796826-55796848 TAAAAAAGAGAAAAGAAGGCTGG + Intronic
1025128077 7:56361301-56361323 TAAAAAAGAGAAAAGAAGGCTGG + Intergenic
1026235431 7:68522624-68522646 CAATCAAGAGGTATGAAGCCAGG - Intergenic
1026330490 7:69348063-69348085 TAAATAAAAGTTAAGAAGGCCGG + Intergenic
1028241210 7:88423306-88423328 TAACCAAGAGCTAAGATTGTAGG + Intergenic
1028920606 7:96306463-96306485 TGCCCAAGAGGTCAGAAGTCTGG - Intronic
1028920625 7:96306593-96306615 TGCCCAAGAGGTCAGAAGTCTGG - Intronic
1031516542 7:122707069-122707091 GAACCAGAAGGTAAGCAGGCAGG + Intronic
1032011213 7:128349394-128349416 GAGCCAAGAGGGAAGCAGGCAGG - Intergenic
1032141416 7:129334414-129334436 TAACTAGGAGTTAGGAAGGCTGG - Intronic
1032440130 7:131936323-131936345 TAACCAAGAGGTAAGAGGAAAGG - Intergenic
1035339584 7:158151654-158151676 GAAACAAGAGGGAAGAAGGAGGG - Intronic
1037635794 8:20700301-20700323 GAACCAAGAGGTGAAAAGGTGGG + Intergenic
1042217782 8:66443619-66443641 TAACCAAGAGATGACCAGGCTGG + Intronic
1043206617 8:77451743-77451765 TAAACAAGAGGAAAGTAGGAAGG - Intergenic
1043373721 8:79624156-79624178 TACCCAAGAAATAAGGAGGCTGG + Intronic
1043570096 8:81593287-81593309 TAATCACTAGGTAAAAAGGCAGG + Intergenic
1044581256 8:93828442-93828464 TTACCAAGAGAAAAGAAGCCAGG + Intergenic
1045127949 8:99114619-99114641 CAATGAAGAGGTAAGAAAGCGGG - Intronic
1045953206 8:107875448-107875470 TAAGCAAGAGAAAGGAAGGCAGG + Intergenic
1046613170 8:116447437-116447459 TAACCAAGATGAATGAAAGCTGG - Intergenic
1047346590 8:124034755-124034777 AAACAAAGAGGTAAAAAGTCAGG + Intronic
1048567912 8:135622944-135622966 TTACCAAGTGGCAGGAAGGCCGG - Intronic
1049152166 8:141041945-141041967 TAAACAGGAGGCAAGAAGGAGGG + Intergenic
1050272258 9:3958931-3958953 TAACTATGAGGTGAGAAGTCTGG + Intronic
1051379782 9:16444452-16444474 TAACCAAGAGGTCAGCACACCGG - Intronic
1053457990 9:38245920-38245942 TAACCAAGAGGCAAGGAAGGAGG - Intergenic
1055238207 9:74150025-74150047 TAAACAAGAGATGAGAATGCAGG + Intergenic
1055911027 9:81351681-81351703 TAACCAAGAGTTAAAAAGCGGGG + Intergenic
1055912628 9:81369722-81369744 GAACTTAGAGGTAAGAAAGCAGG + Intergenic
1056650768 9:88459794-88459816 TAACGAACATGTCAGAAGGCAGG - Intronic
1056844583 9:90025997-90026019 TAAGCAAGAGGAAGCAAGGCAGG + Intergenic
1057279665 9:93700598-93700620 AAAACAAAAGGGAAGAAGGCTGG - Intergenic
1058200779 9:102037078-102037100 TAAACAAAAAGTAAGATGGCAGG + Intergenic
1058315487 9:103560215-103560237 GAACCAAGAGTACAGAAGGCAGG + Intergenic
1061508837 9:131048440-131048462 CAGCCAAGGGGTAAGAAGGAAGG - Intronic
1061871577 9:133523567-133523589 AGACCCAGAGGCAAGAAGGCAGG + Intronic
1203656537 Un_KI270753v1:3179-3201 CAACCAAGCGGTTAGAAGGTTGG + Intergenic
1186596197 X:10984336-10984358 AAACCAGGAGGCAAGCAGGCAGG + Intergenic
1188526108 X:31089298-31089320 TAAACAAGAGTTAAGGCGGCCGG - Intergenic
1194414357 X:93592176-93592198 AAGCAAAGAGTTAAGAAGGCTGG - Intergenic
1195763541 X:108272646-108272668 TAACCAAACAGTAAGAAGACTGG - Intronic
1197329246 X:125133296-125133318 TAAGAAAGGAGTAAGAAGGCCGG - Intergenic
1201666168 Y:16458492-16458514 ACAACTAGAGGTAAGAAGGCAGG + Intergenic
1202382108 Y:24282283-24282305 TAAAAAAGAGAAAAGAAGGCTGG - Intergenic
1202488676 Y:25387842-25387864 TAAAAAAGAGAAAAGAAGGCTGG + Intergenic