ID: 937184719

View in Genome Browser
Species Human (GRCh38)
Location 2:120029484-120029506
Sequence TTATATACATAGGTAGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937184714_937184719 8 Left 937184714 2:120029453-120029475 CCCAAAGTGCTGGGATTATAGGT 0: 6588
1: 101778
2: 322380
3: 233931
4: 142133
Right 937184719 2:120029484-120029506 TTATATACATAGGTAGAGATGGG No data
937184708_937184719 21 Left 937184708 2:120029440-120029462 CCTGCCTCAACCTCCCAAAGTGC 0: 1644
1: 66400
2: 184991
3: 234699
4: 272666
Right 937184719 2:120029484-120029506 TTATATACATAGGTAGAGATGGG No data
937184712_937184719 11 Left 937184712 2:120029450-120029472 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 937184719 2:120029484-120029506 TTATATACATAGGTAGAGATGGG No data
937184715_937184719 7 Left 937184715 2:120029454-120029476 CCAAAGTGCTGGGATTATAGGTA 0: 532
1: 22649
2: 198481
3: 312276
4: 201335
Right 937184719 2:120029484-120029506 TTATATACATAGGTAGAGATGGG No data
937184710_937184719 17 Left 937184710 2:120029444-120029466 CCTCAACCTCCCAAAGTGCTGGG 0: 2404
1: 92992
2: 214605
3: 237519
4: 262205
Right 937184719 2:120029484-120029506 TTATATACATAGGTAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937184719 Original CRISPR TTATATACATAGGTAGAGAT GGG Intronic
No off target data available for this crispr