ID: 937185831

View in Genome Browser
Species Human (GRCh38)
Location 2:120041270-120041292
Sequence ACATTGCAACACAGTGAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937185831_937185832 -7 Left 937185831 2:120041270-120041292 CCACGTTCACTGTGTTGCAATGT No data
Right 937185832 2:120041286-120041308 GCAATGTGTTGTTTTGTTTCAGG No data
937185831_937185833 10 Left 937185831 2:120041270-120041292 CCACGTTCACTGTGTTGCAATGT No data
Right 937185833 2:120041303-120041325 TTCAGGTATATAAGAAACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937185831 Original CRISPR ACATTGCAACACAGTGAACG TGG (reversed) Intronic
No off target data available for this crispr