ID: 937188280

View in Genome Browser
Species Human (GRCh38)
Location 2:120067277-120067299
Sequence GAGAATGGAGAGAAGCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937188276_937188280 16 Left 937188276 2:120067238-120067260 CCACACTGATAGTTCAGTGAATT No data
Right 937188280 2:120067277-120067299 GAGAATGGAGAGAAGCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937188280 Original CRISPR GAGAATGGAGAGAAGCAGCT AGG Intronic
No off target data available for this crispr