ID: 937188280 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:120067277-120067299 |
| Sequence | GAGAATGGAGAGAAGCAGCT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 937188276_937188280 | 16 | Left | 937188276 | 2:120067238-120067260 | CCACACTGATAGTTCAGTGAATT | No data | ||
| Right | 937188280 | 2:120067277-120067299 | GAGAATGGAGAGAAGCAGCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 937188280 | Original CRISPR | GAGAATGGAGAGAAGCAGCT AGG | Intronic | ||
| No off target data available for this crispr | |||||