ID: 937195096

View in Genome Browser
Species Human (GRCh38)
Location 2:120147340-120147362
Sequence GCCCCTTAGAAAAAAAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937195096_937195103 17 Left 937195096 2:120147340-120147362 CCCTGGTTTTTTTTCTAAGGGGC No data
Right 937195103 2:120147380-120147402 CGCCTGTAGTCCCAGCACTTTGG 0: 1317
1: 125776
2: 273984
3: 273283
4: 244396
937195096_937195107 28 Left 937195096 2:120147340-120147362 CCCTGGTTTTTTTTCTAAGGGGC No data
Right 937195107 2:120147391-120147413 CCAGCACTTTGGATCGCCTGAGG 0: 2
1: 10
2: 25
3: 159
4: 972
937195096_937195100 -10 Left 937195096 2:120147340-120147362 CCCTGGTTTTTTTTCTAAGGGGC No data
Right 937195100 2:120147353-120147375 TCTAAGGGGCCAGGCCGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937195096 Original CRISPR GCCCCTTAGAAAAAAAACCA GGG (reversed) Intronic
No off target data available for this crispr