ID: 937203866

View in Genome Browser
Species Human (GRCh38)
Location 2:120223497-120223519
Sequence GCGCGGGGAGGCGAGGATCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 202}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937203866_937203876 6 Left 937203866 2:120223497-120223519 CCGGGATCCTCGCCTCCCCGCGC 0: 1
1: 0
2: 0
3: 23
4: 202
Right 937203876 2:120223526-120223548 CGGCTTCCCGGGAACCCGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 82
937203866_937203873 -6 Left 937203866 2:120223497-120223519 CCGGGATCCTCGCCTCCCCGCGC 0: 1
1: 0
2: 0
3: 23
4: 202
Right 937203873 2:120223514-120223536 CCGCGCTCGCCGCGGCTTCCCGG 0: 1
1: 1
2: 1
3: 9
4: 145
937203866_937203883 23 Left 937203866 2:120223497-120223519 CCGGGATCCTCGCCTCCCCGCGC 0: 1
1: 0
2: 0
3: 23
4: 202
Right 937203883 2:120223543-120223565 GCCCGGGGCTAGAGCGCCCGCGG 0: 1
1: 0
2: 1
3: 8
4: 110
937203866_937203874 -5 Left 937203866 2:120223497-120223519 CCGGGATCCTCGCCTCCCCGCGC 0: 1
1: 0
2: 0
3: 23
4: 202
Right 937203874 2:120223515-120223537 CGCGCTCGCCGCGGCTTCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 133
937203866_937203886 28 Left 937203866 2:120223497-120223519 CCGGGATCCTCGCCTCCCCGCGC 0: 1
1: 0
2: 0
3: 23
4: 202
Right 937203886 2:120223548-120223570 GGGCTAGAGCGCCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 73
937203866_937203878 8 Left 937203866 2:120223497-120223519 CCGGGATCCTCGCCTCCCCGCGC 0: 1
1: 0
2: 0
3: 23
4: 202
Right 937203878 2:120223528-120223550 GCTTCCCGGGAACCCGCCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 80
937203866_937203877 7 Left 937203866 2:120223497-120223519 CCGGGATCCTCGCCTCCCCGCGC 0: 1
1: 0
2: 0
3: 23
4: 202
Right 937203877 2:120223527-120223549 GGCTTCCCGGGAACCCGCCCGGG 0: 1
1: 0
2: 1
3: 17
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937203866 Original CRISPR GCGCGGGGAGGCGAGGATCC CGG (reversed) Intergenic