ID: 937203868

View in Genome Browser
Species Human (GRCh38)
Location 2:120223506-120223528
Sequence TCGCCTCCCCGCGCTCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937203864_937203868 -4 Left 937203864 2:120223487-120223509 CCCATCTCTGCCGGGATCCTCGC 0: 1
1: 0
2: 1
3: 14
4: 102
Right 937203868 2:120223506-120223528 TCGCCTCCCCGCGCTCGCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 99
937203859_937203868 15 Left 937203859 2:120223468-120223490 CCTGGGCGTTGGCACCCTACCCA 0: 1
1: 0
2: 0
3: 2
4: 88
Right 937203868 2:120223506-120223528 TCGCCTCCCCGCGCTCGCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 99
937203862_937203868 1 Left 937203862 2:120223482-120223504 CCCTACCCATCTCTGCCGGGATC 0: 1
1: 0
2: 0
3: 5
4: 131
Right 937203868 2:120223506-120223528 TCGCCTCCCCGCGCTCGCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 99
937203865_937203868 -5 Left 937203865 2:120223488-120223510 CCATCTCTGCCGGGATCCTCGCC 0: 1
1: 0
2: 2
3: 10
4: 119
Right 937203868 2:120223506-120223528 TCGCCTCCCCGCGCTCGCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 99
937203863_937203868 0 Left 937203863 2:120223483-120223505 CCTACCCATCTCTGCCGGGATCC 0: 1
1: 0
2: 0
3: 11
4: 139
Right 937203868 2:120223506-120223528 TCGCCTCCCCGCGCTCGCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937203868 Original CRISPR TCGCCTCCCCGCGCTCGCCG CGG Intergenic