ID: 937203871

View in Genome Browser
Species Human (GRCh38)
Location 2:120223513-120223535
Sequence CGGGAAGCCGCGGCGAGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937203871_937203886 12 Left 937203871 2:120223513-120223535 CCCGCGCTCGCCGCGGCTTCCCG 0: 1
1: 0
2: 3
3: 21
4: 166
Right 937203886 2:120223548-120223570 GGGCTAGAGCGCCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 73
937203871_937203878 -8 Left 937203871 2:120223513-120223535 CCCGCGCTCGCCGCGGCTTCCCG 0: 1
1: 0
2: 3
3: 21
4: 166
Right 937203878 2:120223528-120223550 GCTTCCCGGGAACCCGCCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 80
937203871_937203883 7 Left 937203871 2:120223513-120223535 CCCGCGCTCGCCGCGGCTTCCCG 0: 1
1: 0
2: 3
3: 21
4: 166
Right 937203883 2:120223543-120223565 GCCCGGGGCTAGAGCGCCCGCGG 0: 1
1: 0
2: 1
3: 8
4: 110
937203871_937203877 -9 Left 937203871 2:120223513-120223535 CCCGCGCTCGCCGCGGCTTCCCG 0: 1
1: 0
2: 3
3: 21
4: 166
Right 937203877 2:120223527-120223549 GGCTTCCCGGGAACCCGCCCGGG 0: 1
1: 0
2: 1
3: 17
4: 157
937203871_937203876 -10 Left 937203871 2:120223513-120223535 CCCGCGCTCGCCGCGGCTTCCCG 0: 1
1: 0
2: 3
3: 21
4: 166
Right 937203876 2:120223526-120223548 CGGCTTCCCGGGAACCCGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937203871 Original CRISPR CGGGAAGCCGCGGCGAGCGC GGG (reversed) Intergenic
900513119 1:3069575-3069597 CGGGAACCCGAGGCGCGCGGTGG + Intronic
901489451 1:9589166-9589188 CGGGGGGCGGCGGCGCGCGCCGG - Intronic
901525967 1:9823693-9823715 CGGGCGGCCGGGGCCAGCGCGGG + Exonic
903446157 1:23424174-23424196 CGGGGAGCGGCGGCGATGGCGGG - Intronic
903588813 1:24438593-24438615 GGGGAAGCCTCGGCCAGCTCTGG + Intronic
903925135 1:26826628-26826650 CGGGAGGCCGCGGCGGGCGGTGG + Intergenic
907884173 1:58577490-58577512 CAGGAGGCCGCGCCGAGGGCGGG - Exonic
910777876 1:90893821-90893843 CGGGAAGCCAGTGCTAGCGCTGG - Intergenic
912625859 1:111204230-111204252 CGGGGAGCCGGGGCTAGGGCTGG - Intronic
919640245 1:200039320-200039342 CGGGCAGCGGAGGCGACCGCGGG - Intronic
919764023 1:201114908-201114930 CGGGAGGCCGCGGGAAGCGGGGG + Exonic
920371490 1:205482033-205482055 CGGGCTGCTGCGGCGAGGGCTGG - Intergenic
920924473 1:210328857-210328879 CGGGAACCCGCGGCGCTCTCCGG - Intronic
922440893 1:225653770-225653792 GGCGCAGCCGCGGCGAGGGCGGG - Intergenic
1063449951 10:6144747-6144769 GGGGAAGCCGGGGCGTGGGCCGG - Intergenic
1065140496 10:22714542-22714564 CGCGGATCCGCGGCGGGCGCAGG - Exonic
1069559059 10:69416886-69416908 AGGGAAGCTGCAGCGAGGGCTGG - Intergenic
1073546487 10:104353755-104353777 CGGGCCGACGCGCCGAGCGCGGG + Exonic
1075207045 10:120457085-120457107 CGGGAAGCCGCGCCGGCCGCTGG - Exonic
1075999703 10:126905260-126905282 AGGGGAGCCCCGGCGACCGCGGG + Intergenic
1076371678 10:129959587-129959609 CGGGAAGCCGCGGGAAGCCGCGG - Intronic
1083674683 11:64318847-64318869 CGGGAAGCCGAGGCGGGGGGGGG - Intronic
1087634546 11:100687594-100687616 CCGGCGGCCGCGGCGGGCGCTGG - Intergenic
1090699066 11:129278896-129278918 GCGGAGGCCGCGGGGAGCGCGGG + Intronic
1091585343 12:1812797-1812819 CGGGAAGGAGCGGCGGGCACAGG + Intronic
1094218539 12:27970434-27970456 CGGGAATGAGCGGCGAGCGGCGG + Intronic
1098029008 12:66235293-66235315 CGGGCCGCGGCGGCGGGCGCGGG + Intronic
1100963056 12:99984701-99984723 GAGGAAGCCGAGGCGAGCCCGGG - Intergenic
1105851301 13:24338979-24339001 CGGCCAGCCGCGGTGAGTGCGGG - Intergenic
1106087722 13:26558033-26558055 CGAGAAGCCCCTGCCAGCGCGGG - Intronic
1106517118 13:30465264-30465286 CGGGGCGCCGCGGCGGGCGAGGG - Intronic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1107851454 13:44576669-44576691 CGAGCAGCCGCCGCGAGCCCAGG - Intronic
1113379050 13:109786453-109786475 CGGGAAGCCGGGGTGCGCCCGGG + Exonic
1113625816 13:111845665-111845687 CTGGACCCCGCGGCGAGAGCGGG - Intergenic
1113914829 13:113863951-113863973 CGGGAGGCCGAGGCGAGCCGCGG + Exonic
1114035879 14:18626846-18626868 CTGGAGGCCGCGGCGGGCGCTGG + Intergenic
1114122760 14:19688176-19688198 CTGGAGGCCGCGGCGGGCGCTGG - Intergenic
1114422726 14:22598220-22598242 CGGGAGGCCGCGGGGAGCAAGGG - Exonic
1115325050 14:32128605-32128627 CGGCCAGGCGCGGCGAGCCCAGG - Intronic
1118404809 14:65412745-65412767 GGGGAAGCCTCGGCCAGCGCCGG - Intronic
1118696987 14:68394980-68395002 CGGGGAGCCGAGGCCAGTGCAGG - Intronic
1122628834 14:103098216-103098238 CAGGAAGCCCAGACGAGCGCCGG - Intergenic
1122634439 14:103123516-103123538 CGAGAAGCCGCGCGGAGCGGCGG - Exonic
1122904504 14:104795584-104795606 CTGGAGGCCGCGGCGGGCGGGGG + Intronic
1123671592 15:22664605-22664627 CGGGGTTCCGCGGCGCGCGCCGG + Intergenic
1124323630 15:28737830-28737852 CGGGGTTCCGCGGCGCGCGCCGG + Intronic
1124439231 15:29674911-29674933 CGGGAAGGGGCGGGGAGCGCCGG - Intergenic
1124527532 15:30471083-30471105 CGGGGTTCCGCGGCGCGCGCTGG + Intergenic
1124771127 15:32536619-32536641 CGGGGTTCCGCGGCGCGCGCTGG - Intergenic
1126668404 15:51094649-51094671 CGGGCAGCCGCGGCGCACTCAGG + Exonic
1127071343 15:55290306-55290328 CGGGAAGCCGGGGGCAGGGCCGG - Intronic
1128067700 15:64775112-64775134 CGGGAAGGCGCCGGGAGCGATGG + Intronic
1128318117 15:66673795-66673817 CGGGAAGGCGGGGCTGGCGCAGG - Intronic
1129711000 15:77820135-77820157 CGCGGAGCCGCGGAGAGCGGAGG - Intronic
1131061938 15:89409810-89409832 CGGGAAGCCGCCAAGAGGGCGGG + Intergenic
1132512678 16:352289-352311 CCGGAAGCGGCGGGGGGCGCGGG - Intronic
1132572376 16:649648-649670 GGGGAAGGCGCGGAGAGCCCCGG + Intronic
1132831359 16:1929908-1929930 CGGGAGGCCGCCTCGAGGGCCGG + Intergenic
1133020275 16:2964062-2964084 CGGGAAGCCCCGCCCAGCACTGG - Exonic
1135040749 16:19115050-19115072 CGGAAGGCCGGGGCCAGCGCTGG - Exonic
1135298325 16:21301935-21301957 CGGGGAGCAGCTGCAAGCGCAGG - Intronic
1136247702 16:28985040-28985062 CAGGAAGCTGTGGTGAGCGCCGG - Intronic
1136779103 16:32885955-32885977 CGGGCAGCCGCCGCGGGCCCCGG - Intergenic
1136891514 16:33975563-33975585 CGGGCAGCCGCCGCGGGCCCCGG + Intergenic
1138016736 16:53434968-53434990 CAGGAAAGCGCGGCGAGAGCGGG - Intronic
1139383563 16:66549751-66549773 CGCGAGACCGCAGCGAGCGCTGG - Intronic
1139472238 16:67184440-67184462 CAGGAGGCCGGCGCGAGCGCGGG + Exonic
1139754606 16:69132439-69132461 CGGGAGGCTGCGGGGAGCGAGGG - Intronic
1139754681 16:69132709-69132731 TGGGAAGCGGCTGCGAGAGCTGG + Intronic
1139903543 16:70346868-70346890 CCGGAAGCGGCGGTGAGCACAGG - Exonic
1140442643 16:74999314-74999336 AGGGAGGCGGCGGCGAGCGGCGG - Exonic
1142350355 16:89576676-89576698 CGCGAAGCCGCAGCGGGCGGAGG + Intronic
1203081518 16_KI270728v1_random:1148043-1148065 CGGGCAGCCGCCGCGGGCCCCGG - Intergenic
1143078825 17:4366542-4366564 CGGGCTGCCGCGGCGCGCACTGG + Intronic
1143172863 17:4940038-4940060 CTGGAAGCCGGCGCGGGCGCAGG + Exonic
1143904610 17:10198720-10198742 CGGGCTGCCGCCGCGAGGGCTGG + Intergenic
1145938159 17:28726879-28726901 CGGGGAGCCGGGCCGAGGGCCGG - Intronic
1148653819 17:49268584-49268606 CGGTAGGCCGTGGTGAGCGCTGG - Intergenic
1149701806 17:58661554-58661576 CGGGGAGCCGCGGCGGCGGCAGG + Intronic
1150108556 17:62479013-62479035 CGGGCGGCCGCGGGGGGCGCGGG - Exonic
1150108605 17:62479130-62479152 CGGGCAGCCGCCGCCGGCGCCGG - Exonic
1151537741 17:74748459-74748481 CGGGGCGCCGCGCCGAGCGCAGG + Intergenic
1151682087 17:75627612-75627634 CTGGAAGGAGCGGTGAGCGCTGG - Exonic
1151892554 17:76959173-76959195 CAGGAAGCCTCGGCCTGCGCTGG + Intergenic
1152362557 17:79839397-79839419 CCGGGAGCCGGGGCGGGCGCGGG - Exonic
1152680794 17:81666817-81666839 TGGGAGTCCCCGGCGAGCGCGGG + Exonic
1152721747 17:81927071-81927093 CGGGGGTCCGCGGCGAGCCCGGG - Intronic
1152728763 17:81960046-81960068 CGGGACGCCGCGGGGAGCGCGGG + Intronic
1152808796 17:82371636-82371658 CGGGAAGACGCGGGGGTCGCGGG - Intergenic
1152852864 17:82648099-82648121 CTGGGAGCAGCGGCGAGGGCCGG + Intronic
1153900743 18:9614860-9614882 CGGGACCCTGCGGCGAGTGCCGG + Intronic
1157545130 18:48541112-48541134 AAGGCAGCGGCGGCGAGCGCGGG - Intronic
1157610099 18:48950606-48950628 CCGGAGGCCGGGGCGCGCGCGGG + Exonic
1160897052 19:1407932-1407954 CGCGAAGCCGCGGCGAGTCCGGG - Intronic
1161199173 19:3005091-3005113 CTGGACGCCGCCGAGAGCGCGGG - Intronic
1162551635 19:11361421-11361443 GGGGAAGGCGCGGCGCGCGGCGG - Exonic
1162555385 19:11383136-11383158 TGGGAGGAAGCGGCGAGCGCTGG - Exonic
1163103354 19:15110098-15110120 CGGGGGGCTGCGGCCAGCGCCGG + Exonic
1165080477 19:33303389-33303411 CTGGACGCCGGGGCGAGCACGGG + Intergenic
1166621433 19:44304861-44304883 AGAGAAGCCGCGGCCAGCGCTGG - Intronic
1167080833 19:47275175-47275197 AGGGAGGCAGCGGCGGGCGCCGG - Exonic
1167258093 19:48442988-48443010 CGGGAAGCCGGGGAAGGCGCCGG - Exonic
1167339363 19:48905755-48905777 CGGGAAGCTGAGCCGAGAGCTGG + Exonic
1168154512 19:54465325-54465347 CGGGCGGCGGCGGGGAGCGCGGG + Exonic
931309656 2:61066107-61066129 TGGGAAGCCGCGGCGGGAGCCGG - Intronic
931429148 2:62195923-62195945 CTGGAAGCCGCAGGGAGCGCGGG + Intergenic
936105048 2:109615706-109615728 CGGGTAGCGGCGGCGGGCGCTGG + Exonic
937203871 2:120223513-120223535 CGGGAAGCCGCGGCGAGCGCGGG - Intergenic
937221385 2:120344804-120344826 TGGGAAGCAGGGGTGAGCGCGGG + Intergenic
938077383 2:128346932-128346954 AGGGAAGCAGCGGCGGGCGGGGG + Intergenic
938274518 2:130006118-130006140 CTGGCAGCCGCGACGTGCGCTGG - Intergenic
940293491 2:152099198-152099220 CGGGACCCCGCCGCGAGCGCGGG - Intergenic
942116765 2:172735825-172735847 CGGGAGCCCGCGGGGAGGGCGGG + Exonic
944517373 2:200526059-200526081 CGGGACGCCGCTGCTAGGGCAGG - Intronic
945119644 2:206444026-206444048 CGGGACGAGGCGGCGAGCGGAGG - Exonic
947641078 2:231708150-231708172 CGAGCAGCCGCGGGGAGGGCGGG + Intronic
948913103 2:241015600-241015622 CGGGAGGCCTCAGCCAGCGCAGG - Intronic
1168757084 20:325471-325493 CGGGCCGCTGCGGCGCGCGCGGG - Exonic
1169327254 20:4686382-4686404 AGGGAAGCGGCGGCGCTCGCGGG - Exonic
1170852468 20:20017514-20017536 CGGGAAGGCGCGGCTGGGGCCGG - Intronic
1171852247 20:30316933-30316955 CGGGGAGCCGCGGCGAGGGCTGG - Intergenic
1172118644 20:32585244-32585266 CGGGGAGCGGCCCCGAGCGCTGG + Intronic
1172273395 20:33667097-33667119 CGGGGAGCCGCCGCGTGCACCGG + Exonic
1176126124 20:63475663-63475685 CGGGAAGCCCGGGGGAGCCCGGG - Intergenic
1176555526 21:8252703-8252725 GGGGGAGCCGCGGGGATCGCCGG + Intergenic
1180460000 22:15553900-15553922 CTGGAGGCCGCGGCGGGCGCTGG + Intergenic
1184689854 22:46112585-46112607 CGGGCAGGCGCGGTGGGCGCAGG - Intronic
1184745945 22:46456183-46456205 CTGGAAGCCACAGCGAGCACTGG + Intronic
1185055501 22:48576630-48576652 CTGGAAGCCGGGTCGGGCGCCGG - Intronic
1185296726 22:50058341-50058363 CGGGGAGCTGCGGCGTGCGGGGG + Intergenic
955356615 3:58237547-58237569 CCGAAAGCCACGGCGAGAGCAGG - Exonic
957792546 3:84959273-84959295 CGGGCAGCCCCGGCGGGCTCTGG + Intronic
960586194 3:119323178-119323200 CGGGAAGCGGCCGGGGGCGCGGG - Intronic
961067013 3:123884239-123884261 CGGGGCGCCCCGCCGAGCGCCGG - Intronic
961665118 3:128489597-128489619 CGGGAAGCCGCGCAGGGGGCGGG + Intronic
966787849 3:183636462-183636484 CGGGGAGCCGGGGCGGGCGGGGG + Intronic
967171720 3:186827343-186827365 CGGGGAGCCGGGGCGACCGCAGG - Intergenic
967849467 3:194071115-194071137 CGGGGAGACGCGGCGGGCGCGGG + Intergenic
968701276 4:2059328-2059350 CGGGCGGCCGGGGCGCGCGCAGG - Intergenic
968845986 4:3041799-3041821 GCGGAAGCCGCAGCCAGCGCCGG - Intergenic
968886421 4:3336246-3336268 CGGGAAGCCGCTGCCACCCCAGG - Intronic
969138794 4:5051635-5051657 GCGGAAGGCGCGGCGAGAGCGGG + Exonic
969713192 4:8856096-8856118 TGGGAAGCCGCTGTGAGCGCTGG + Intronic
970333328 4:15004771-15004793 CGGGGAGGCGCGGCGAGGACCGG + Intronic
971195696 4:24470743-24470765 CGGGAGGCGGCGGCGAGCTCTGG - Intergenic
973293098 4:48489875-48489897 CGGGAAGCCGAGGCCAGGCCGGG - Intergenic
976389357 4:84493263-84493285 CGGGAAGGTGCGGCGGGCGGCGG + Exonic
977810044 4:101347438-101347460 GGGGAGGCAGAGGCGAGCGCGGG - Exonic
978384703 4:108167962-108167984 CGGGAAAGCGCGGCGGCCGCCGG - Exonic
992866336 5:80960560-80960582 CGGGAGGCCGCGGCGCGCGGTGG - Intergenic
998328567 5:141303935-141303957 CGTCCAGCCGCAGCGAGCGCGGG + Intergenic
1000463331 5:161547897-161547919 CGGGAGTGGGCGGCGAGCGCGGG - Intronic
1001725001 5:173888943-173888965 GAGGAAGCCGCGGGGAGCCCAGG + Exonic
1001902703 5:175444683-175444705 CGGGGCGCAGCGGCGCGCGCTGG - Intergenic
1003871123 6:10404288-10404310 GGGAAAGCAGCGGAGAGCGCAGG + Intronic
1004140640 6:13014159-13014181 GGGGCGGCGGCGGCGAGCGCGGG + Intronic
1004504715 6:16238617-16238639 CGGGGCGGCGCGGGGAGCGCCGG - Exonic
1011517261 6:88167037-88167059 CGGGAAAGGGCGGCGGGCGCTGG - Intergenic
1019179125 6:170176159-170176181 AGGCAAGCCGCGGCGGGAGCAGG - Intergenic
1020110635 7:5446068-5446090 CGGGAAGCTGCAGGGAGGGCTGG + Intronic
1020445250 7:8261729-8261751 CGGGAAGGCGAGGCGCGCGGTGG + Intronic
1023287127 7:38631476-38631498 CGGGGAGCCGCGGAGCGCGGAGG + Exonic
1023638593 7:42237129-42237151 CGGGCGGCCGCGGGGCGCGCGGG + Intronic
1024280251 7:47712643-47712665 CGAGAAGCAGCAGAGAGCGCGGG - Intronic
1024471824 7:49774046-49774068 GGGGTAGCAGCGGCGGGCGCGGG - Exonic
1024919389 7:54542222-54542244 CGGGCGGCCGCGGAGGGCGCAGG - Intergenic
1026876887 7:73884576-73884598 CGGGAGGCCGAGGTGAGCCCAGG - Intergenic
1027138233 7:75639291-75639313 CGCGGAGCCGCAGCGCGCGCCGG + Intronic
1030292678 7:107888070-107888092 CGGCCAGCCGCTGCGAGTGCAGG - Intergenic
1034464583 7:151219120-151219142 CGTGAAGACGCGGCTAGAGCTGG - Exonic
1035179453 7:157078477-157078499 CGGGAAGCCGCCGCGGGCCTGGG - Intergenic
1035295108 7:157862810-157862832 CGGGAAGCGGCGAGGTGCGCGGG + Intronic
1038157025 8:25000604-25000626 CGGGAAGCCGCACCCAGAGCTGG + Intergenic
1040571439 8:48614976-48614998 GGAGAAGCCGCGGCCAGCACTGG - Intergenic
1044873810 8:96645200-96645222 CGGGAAGCCGGGGCGGGCGCCGG - Intergenic
1045674077 8:104589015-104589037 CCCGCAGCCGCGGAGAGCGCAGG - Intronic
1049585695 8:143431415-143431437 TGGGGGGCCGCGGAGAGCGCAGG + Intergenic
1053312073 9:37026597-37026619 CGGGAGGCGGCGGCGTGGGCCGG - Intronic
1056135155 9:83623454-83623476 GGGGAGGCTGCGGCGACCGCAGG + Intronic
1060770304 9:126327194-126327216 CCGGCAGCCGCGGCGCGCTCGGG - Intronic
1060915478 9:127387048-127387070 CGGGATGCCGGGGCGAGGGATGG - Intronic
1061347944 9:130042456-130042478 GGGGCGGCCGGGGCGAGCGCCGG - Intronic
1061666232 9:132162218-132162240 CGGGAAGCCGCTCCGAGCCGGGG + Exonic
1062162458 9:135087803-135087825 GGGGAAGGCGCGGCGATGGCCGG + Exonic
1185469330 X:373425-373447 CGGCCAGCAGCGGCGAGCGGGGG + Intronic
1185469361 X:373503-373525 CGGGCAGCCGCGGGGCGCGCGGG + Intronic
1187172987 X:16869963-16869985 CGCGAGGCCGCGGCACGCGCCGG - Intronic
1192624541 X:72714089-72714111 CGGGAAGCCAGTGCTAGCGCTGG - Intronic
1197448427 X:126580963-126580985 CGAGAAGCGGTGGCGAGCGGAGG + Intergenic
1200145806 X:153926169-153926191 CGGGAAGCTGCGGCGGGAGCGGG - Exonic