ID: 937203871

View in Genome Browser
Species Human (GRCh38)
Location 2:120223513-120223535
Sequence CGGGAAGCCGCGGCGAGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937203871_937203877 -9 Left 937203871 2:120223513-120223535 CCCGCGCTCGCCGCGGCTTCCCG 0: 1
1: 0
2: 3
3: 21
4: 166
Right 937203877 2:120223527-120223549 GGCTTCCCGGGAACCCGCCCGGG 0: 1
1: 0
2: 1
3: 17
4: 157
937203871_937203883 7 Left 937203871 2:120223513-120223535 CCCGCGCTCGCCGCGGCTTCCCG 0: 1
1: 0
2: 3
3: 21
4: 166
Right 937203883 2:120223543-120223565 GCCCGGGGCTAGAGCGCCCGCGG 0: 1
1: 0
2: 1
3: 8
4: 110
937203871_937203876 -10 Left 937203871 2:120223513-120223535 CCCGCGCTCGCCGCGGCTTCCCG 0: 1
1: 0
2: 3
3: 21
4: 166
Right 937203876 2:120223526-120223548 CGGCTTCCCGGGAACCCGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 82
937203871_937203878 -8 Left 937203871 2:120223513-120223535 CCCGCGCTCGCCGCGGCTTCCCG 0: 1
1: 0
2: 3
3: 21
4: 166
Right 937203878 2:120223528-120223550 GCTTCCCGGGAACCCGCCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 80
937203871_937203886 12 Left 937203871 2:120223513-120223535 CCCGCGCTCGCCGCGGCTTCCCG 0: 1
1: 0
2: 3
3: 21
4: 166
Right 937203886 2:120223548-120223570 GGGCTAGAGCGCCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937203871 Original CRISPR CGGGAAGCCGCGGCGAGCGC GGG (reversed) Intergenic