ID: 937203875 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:120223523-120223545 |
Sequence | GGCGGGTTCCCGGGAAGCCG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 223 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 16, 4: 204} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
937203875_937203883 | -3 | Left | 937203875 | 2:120223523-120223545 | CCGCGGCTTCCCGGGAACCCGCC | 0: 1 1: 0 2: 2 3: 16 4: 204 |
||
Right | 937203883 | 2:120223543-120223565 | GCCCGGGGCTAGAGCGCCCGCGG | 0: 1 1: 0 2: 1 3: 8 4: 110 |
||||
937203875_937203886 | 2 | Left | 937203875 | 2:120223523-120223545 | CCGCGGCTTCCCGGGAACCCGCC | 0: 1 1: 0 2: 2 3: 16 4: 204 |
||
Right | 937203886 | 2:120223548-120223570 | GGGCTAGAGCGCCCGCGGTGAGG | 0: 1 1: 0 2: 0 3: 3 4: 73 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
937203875 | Original CRISPR | GGCGGGTTCCCGGGAAGCCG CGG (reversed) | Intergenic | ||