ID: 937203876

View in Genome Browser
Species Human (GRCh38)
Location 2:120223526-120223548
Sequence CGGCTTCCCGGGAACCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 82}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937203866_937203876 6 Left 937203866 2:120223497-120223519 CCGGGATCCTCGCCTCCCCGCGC 0: 1
1: 0
2: 0
3: 23
4: 202
Right 937203876 2:120223526-120223548 CGGCTTCCCGGGAACCCGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 82
937203862_937203876 21 Left 937203862 2:120223482-120223504 CCCTACCCATCTCTGCCGGGATC 0: 1
1: 0
2: 0
3: 5
4: 131
Right 937203876 2:120223526-120223548 CGGCTTCCCGGGAACCCGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 82
937203865_937203876 15 Left 937203865 2:120223488-120223510 CCATCTCTGCCGGGATCCTCGCC 0: 1
1: 0
2: 2
3: 10
4: 119
Right 937203876 2:120223526-120223548 CGGCTTCCCGGGAACCCGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 82
937203863_937203876 20 Left 937203863 2:120223483-120223505 CCTACCCATCTCTGCCGGGATCC 0: 1
1: 0
2: 0
3: 11
4: 139
Right 937203876 2:120223526-120223548 CGGCTTCCCGGGAACCCGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 82
937203864_937203876 16 Left 937203864 2:120223487-120223509 CCCATCTCTGCCGGGATCCTCGC 0: 1
1: 0
2: 1
3: 14
4: 102
Right 937203876 2:120223526-120223548 CGGCTTCCCGGGAACCCGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 82
937203871_937203876 -10 Left 937203871 2:120223513-120223535 CCCGCGCTCGCCGCGGCTTCCCG 0: 1
1: 0
2: 3
3: 21
4: 166
Right 937203876 2:120223526-120223548 CGGCTTCCCGGGAACCCGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 82
937203870_937203876 -9 Left 937203870 2:120223512-120223534 CCCCGCGCTCGCCGCGGCTTCCC 0: 1
1: 0
2: 1
3: 27
4: 206
Right 937203876 2:120223526-120223548 CGGCTTCCCGGGAACCCGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 82
937203867_937203876 -1 Left 937203867 2:120223504-120223526 CCTCGCCTCCCCGCGCTCGCCGC 0: 1
1: 0
2: 14
3: 62
4: 644
Right 937203876 2:120223526-120223548 CGGCTTCCCGGGAACCCGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 82
937203869_937203876 -6 Left 937203869 2:120223509-120223531 CCTCCCCGCGCTCGCCGCGGCTT 0: 1
1: 0
2: 1
3: 23
4: 206
Right 937203876 2:120223526-120223548 CGGCTTCCCGGGAACCCGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937203876 Original CRISPR CGGCTTCCCGGGAACCCGCC CGG Intergenic