ID: 937203878

View in Genome Browser
Species Human (GRCh38)
Location 2:120223528-120223550
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 80}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937203870_937203878 -7 Left 937203870 2:120223512-120223534 CCCCGCGCTCGCCGCGGCTTCCC 0: 1
1: 0
2: 1
3: 27
4: 206
Right 937203878 2:120223528-120223550 GCTTCCCGGGAACCCGCCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 80
937203872_937203878 -9 Left 937203872 2:120223514-120223536 CCGCGCTCGCCGCGGCTTCCCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 937203878 2:120223528-120223550 GCTTCCCGGGAACCCGCCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 80
937203871_937203878 -8 Left 937203871 2:120223513-120223535 CCCGCGCTCGCCGCGGCTTCCCG 0: 1
1: 0
2: 3
3: 21
4: 166
Right 937203878 2:120223528-120223550 GCTTCCCGGGAACCCGCCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 80
937203863_937203878 22 Left 937203863 2:120223483-120223505 CCTACCCATCTCTGCCGGGATCC 0: 1
1: 0
2: 0
3: 11
4: 139
Right 937203878 2:120223528-120223550 GCTTCCCGGGAACCCGCCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 80
937203867_937203878 1 Left 937203867 2:120223504-120223526 CCTCGCCTCCCCGCGCTCGCCGC 0: 1
1: 0
2: 14
3: 62
4: 644
Right 937203878 2:120223528-120223550 GCTTCCCGGGAACCCGCCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 80
937203862_937203878 23 Left 937203862 2:120223482-120223504 CCCTACCCATCTCTGCCGGGATC 0: 1
1: 0
2: 0
3: 5
4: 131
Right 937203878 2:120223528-120223550 GCTTCCCGGGAACCCGCCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 80
937203864_937203878 18 Left 937203864 2:120223487-120223509 CCCATCTCTGCCGGGATCCTCGC 0: 1
1: 0
2: 1
3: 14
4: 102
Right 937203878 2:120223528-120223550 GCTTCCCGGGAACCCGCCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 80
937203866_937203878 8 Left 937203866 2:120223497-120223519 CCGGGATCCTCGCCTCCCCGCGC 0: 1
1: 0
2: 0
3: 23
4: 202
Right 937203878 2:120223528-120223550 GCTTCCCGGGAACCCGCCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 80
937203865_937203878 17 Left 937203865 2:120223488-120223510 CCATCTCTGCCGGGATCCTCGCC 0: 1
1: 0
2: 2
3: 10
4: 119
Right 937203878 2:120223528-120223550 GCTTCCCGGGAACCCGCCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 80
937203869_937203878 -4 Left 937203869 2:120223509-120223531 CCTCCCCGCGCTCGCCGCGGCTT 0: 1
1: 0
2: 1
3: 23
4: 206
Right 937203878 2:120223528-120223550 GCTTCCCGGGAACCCGCCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type