ID: 937203879

View in Genome Browser
Species Human (GRCh38)
Location 2:120223532-120223554
Sequence CTAGCCCCGGGCGGGTTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937203879_937203890 22 Left 937203879 2:120223532-120223554 CCCGGGAACCCGCCCGGGGCTAG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 937203890 2:120223577-120223599 CACCCCGCGCGCGCGAGCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 66
937203879_937203895 28 Left 937203879 2:120223532-120223554 CCCGGGAACCCGCCCGGGGCTAG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 937203895 2:120223583-120223605 GCGCGCGCGAGCAGAGGCGGTGG 0: 1
1: 0
2: 0
3: 15
4: 229
937203879_937203893 25 Left 937203879 2:120223532-120223554 CCCGGGAACCCGCCCGGGGCTAG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 937203893 2:120223580-120223602 CCCGCGCGCGCGAGCAGAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 107
937203879_937203886 -7 Left 937203879 2:120223532-120223554 CCCGGGAACCCGCCCGGGGCTAG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 937203886 2:120223548-120223570 GGGCTAGAGCGCCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937203879 Original CRISPR CTAGCCCCGGGCGGGTTCCC GGG (reversed) Intergenic