ID: 937203886

View in Genome Browser
Species Human (GRCh38)
Location 2:120223548-120223570
Sequence GGGCTAGAGCGCCCGCGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937203870_937203886 13 Left 937203870 2:120223512-120223534 CCCCGCGCTCGCCGCGGCTTCCC 0: 1
1: 0
2: 1
3: 27
4: 206
Right 937203886 2:120223548-120223570 GGGCTAGAGCGCCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 73
937203867_937203886 21 Left 937203867 2:120223504-120223526 CCTCGCCTCCCCGCGCTCGCCGC 0: 1
1: 0
2: 14
3: 62
4: 644
Right 937203886 2:120223548-120223570 GGGCTAGAGCGCCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 73
937203875_937203886 2 Left 937203875 2:120223523-120223545 CCGCGGCTTCCCGGGAACCCGCC 0: 1
1: 0
2: 2
3: 16
4: 204
Right 937203886 2:120223548-120223570 GGGCTAGAGCGCCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 73
937203872_937203886 11 Left 937203872 2:120223514-120223536 CCGCGCTCGCCGCGGCTTCCCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 937203886 2:120223548-120223570 GGGCTAGAGCGCCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 73
937203866_937203886 28 Left 937203866 2:120223497-120223519 CCGGGATCCTCGCCTCCCCGCGC 0: 1
1: 0
2: 0
3: 23
4: 202
Right 937203886 2:120223548-120223570 GGGCTAGAGCGCCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 73
937203880_937203886 -8 Left 937203880 2:120223533-120223555 CCGGGAACCCGCCCGGGGCTAGA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 937203886 2:120223548-120223570 GGGCTAGAGCGCCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 73
937203879_937203886 -7 Left 937203879 2:120223532-120223554 CCCGGGAACCCGCCCGGGGCTAG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 937203886 2:120223548-120223570 GGGCTAGAGCGCCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 73
937203871_937203886 12 Left 937203871 2:120223513-120223535 CCCGCGCTCGCCGCGGCTTCCCG 0: 1
1: 0
2: 3
3: 21
4: 166
Right 937203886 2:120223548-120223570 GGGCTAGAGCGCCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 73
937203869_937203886 16 Left 937203869 2:120223509-120223531 CCTCCCCGCGCTCGCCGCGGCTT 0: 1
1: 0
2: 1
3: 23
4: 206
Right 937203886 2:120223548-120223570 GGGCTAGAGCGCCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937203886 Original CRISPR GGGCTAGAGCGCCCGCGGTG AGG Intergenic