ID: 937204359

View in Genome Browser
Species Human (GRCh38)
Location 2:120225974-120225996
Sequence CCAGGGGTCGAGGTTTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204359_937204377 30 Left 937204359 2:120225974-120225996 CCCTGAGAAACCTCGACCCCTGG No data
Right 937204377 2:120226027-120226049 AGCATCTGGGTGCCAGAGGTGGG No data
937204359_937204370 16 Left 937204359 2:120225974-120225996 CCCTGAGAAACCTCGACCCCTGG No data
Right 937204370 2:120226013-120226035 CTCTCACCTCCCACAGCATCTGG No data
937204359_937204371 17 Left 937204359 2:120225974-120225996 CCCTGAGAAACCTCGACCCCTGG No data
Right 937204371 2:120226014-120226036 TCTCACCTCCCACAGCATCTGGG No data
937204359_937204376 29 Left 937204359 2:120225974-120225996 CCCTGAGAAACCTCGACCCCTGG No data
Right 937204376 2:120226026-120226048 CAGCATCTGGGTGCCAGAGGTGG No data
937204359_937204375 26 Left 937204359 2:120225974-120225996 CCCTGAGAAACCTCGACCCCTGG No data
Right 937204375 2:120226023-120226045 CCACAGCATCTGGGTGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937204359 Original CRISPR CCAGGGGTCGAGGTTTCTCA GGG (reversed) Intergenic