ID: 937204361

View in Genome Browser
Species Human (GRCh38)
Location 2:120225975-120225997
Sequence ACCAGGGGTCGAGGTTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204361_937204376 28 Left 937204361 2:120225975-120225997 CCTGAGAAACCTCGACCCCTGGT No data
Right 937204376 2:120226026-120226048 CAGCATCTGGGTGCCAGAGGTGG No data
937204361_937204371 16 Left 937204361 2:120225975-120225997 CCTGAGAAACCTCGACCCCTGGT No data
Right 937204371 2:120226014-120226036 TCTCACCTCCCACAGCATCTGGG No data
937204361_937204377 29 Left 937204361 2:120225975-120225997 CCTGAGAAACCTCGACCCCTGGT No data
Right 937204377 2:120226027-120226049 AGCATCTGGGTGCCAGAGGTGGG No data
937204361_937204375 25 Left 937204361 2:120225975-120225997 CCTGAGAAACCTCGACCCCTGGT No data
Right 937204375 2:120226023-120226045 CCACAGCATCTGGGTGCCAGAGG No data
937204361_937204370 15 Left 937204361 2:120225975-120225997 CCTGAGAAACCTCGACCCCTGGT No data
Right 937204370 2:120226013-120226035 CTCTCACCTCCCACAGCATCTGG No data
937204361_937204378 30 Left 937204361 2:120225975-120225997 CCTGAGAAACCTCGACCCCTGGT No data
Right 937204378 2:120226028-120226050 GCATCTGGGTGCCAGAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937204361 Original CRISPR ACCAGGGGTCGAGGTTTCTC AGG (reversed) Intergenic