ID: 937204363

View in Genome Browser
Species Human (GRCh38)
Location 2:120225984-120226006
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204363_937204380 26 Left 937204363 2:120225984-120226006 CCTCGACCCCTGGTGGACCAGTG No data
Right 937204380 2:120226033-120226055 TGGGTGCCAGAGGTGGGGTAGGG No data
937204363_937204375 16 Left 937204363 2:120225984-120226006 CCTCGACCCCTGGTGGACCAGTG No data
Right 937204375 2:120226023-120226045 CCACAGCATCTGGGTGCCAGAGG No data
937204363_937204377 20 Left 937204363 2:120225984-120226006 CCTCGACCCCTGGTGGACCAGTG No data
Right 937204377 2:120226027-120226049 AGCATCTGGGTGCCAGAGGTGGG No data
937204363_937204370 6 Left 937204363 2:120225984-120226006 CCTCGACCCCTGGTGGACCAGTG No data
Right 937204370 2:120226013-120226035 CTCTCACCTCCCACAGCATCTGG No data
937204363_937204378 21 Left 937204363 2:120225984-120226006 CCTCGACCCCTGGTGGACCAGTG No data
Right 937204378 2:120226028-120226050 GCATCTGGGTGCCAGAGGTGGGG No data
937204363_937204371 7 Left 937204363 2:120225984-120226006 CCTCGACCCCTGGTGGACCAGTG No data
Right 937204371 2:120226014-120226036 TCTCACCTCCCACAGCATCTGGG No data
937204363_937204376 19 Left 937204363 2:120225984-120226006 CCTCGACCCCTGGTGGACCAGTG No data
Right 937204376 2:120226026-120226048 CAGCATCTGGGTGCCAGAGGTGG No data
937204363_937204381 27 Left 937204363 2:120225984-120226006 CCTCGACCCCTGGTGGACCAGTG No data
Right 937204381 2:120226034-120226056 GGGTGCCAGAGGTGGGGTAGGGG No data
937204363_937204379 25 Left 937204363 2:120225984-120226006 CCTCGACCCCTGGTGGACCAGTG No data
Right 937204379 2:120226032-120226054 CTGGGTGCCAGAGGTGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937204363 Original CRISPR CACTGGTCCACCAGGGGTCG AGG (reversed) Intergenic