ID: 937204364

View in Genome Browser
Species Human (GRCh38)
Location 2:120225990-120226012
Sequence AAGGGTCACTGGTCCACCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204364_937204375 10 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204375 2:120226023-120226045 CCACAGCATCTGGGTGCCAGAGG No data
937204364_937204376 13 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204376 2:120226026-120226048 CAGCATCTGGGTGCCAGAGGTGG No data
937204364_937204378 15 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204378 2:120226028-120226050 GCATCTGGGTGCCAGAGGTGGGG No data
937204364_937204384 28 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204384 2:120226041-120226063 AGAGGTGGGGTAGGGGCAGGCGG No data
937204364_937204379 19 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204379 2:120226032-120226054 CTGGGTGCCAGAGGTGGGGTAGG No data
937204364_937204377 14 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204377 2:120226027-120226049 AGCATCTGGGTGCCAGAGGTGGG No data
937204364_937204381 21 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204381 2:120226034-120226056 GGGTGCCAGAGGTGGGGTAGGGG No data
937204364_937204386 30 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204386 2:120226043-120226065 AGGTGGGGTAGGGGCAGGCGGGG No data
937204364_937204370 0 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204370 2:120226013-120226035 CTCTCACCTCCCACAGCATCTGG No data
937204364_937204385 29 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204385 2:120226042-120226064 GAGGTGGGGTAGGGGCAGGCGGG No data
937204364_937204380 20 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204380 2:120226033-120226055 TGGGTGCCAGAGGTGGGGTAGGG No data
937204364_937204371 1 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204371 2:120226014-120226036 TCTCACCTCCCACAGCATCTGGG No data
937204364_937204382 25 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204382 2:120226038-120226060 GCCAGAGGTGGGGTAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937204364 Original CRISPR AAGGGTCACTGGTCCACCAG GGG (reversed) Intergenic