ID: 937204368

View in Genome Browser
Species Human (GRCh38)
Location 2:120226008-120226030
Sequence TGCTGTGGGAGGTGAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204368_937204375 -8 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204375 2:120226023-120226045 CCACAGCATCTGGGTGCCAGAGG No data
937204368_937204379 1 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204379 2:120226032-120226054 CTGGGTGCCAGAGGTGGGGTAGG No data
937204368_937204387 30 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204387 2:120226061-120226083 CGGGGACCTTGTTCCTATCCTGG No data
937204368_937204382 7 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204382 2:120226038-120226060 GCCAGAGGTGGGGTAGGGGCAGG No data
937204368_937204376 -5 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204376 2:120226026-120226048 CAGCATCTGGGTGCCAGAGGTGG No data
937204368_937204385 11 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204385 2:120226042-120226064 GAGGTGGGGTAGGGGCAGGCGGG No data
937204368_937204378 -3 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204378 2:120226028-120226050 GCATCTGGGTGCCAGAGGTGGGG No data
937204368_937204377 -4 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204377 2:120226027-120226049 AGCATCTGGGTGCCAGAGGTGGG No data
937204368_937204386 12 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204386 2:120226043-120226065 AGGTGGGGTAGGGGCAGGCGGGG No data
937204368_937204384 10 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204384 2:120226041-120226063 AGAGGTGGGGTAGGGGCAGGCGG No data
937204368_937204381 3 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204381 2:120226034-120226056 GGGTGCCAGAGGTGGGGTAGGGG No data
937204368_937204380 2 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204380 2:120226033-120226055 TGGGTGCCAGAGGTGGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937204368 Original CRISPR TGCTGTGGGAGGTGAGAGAA GGG (reversed) Intergenic
No off target data available for this crispr