ID: 937204370

View in Genome Browser
Species Human (GRCh38)
Location 2:120226013-120226035
Sequence CTCTCACCTCCCACAGCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204361_937204370 15 Left 937204361 2:120225975-120225997 CCTGAGAAACCTCGACCCCTGGT No data
Right 937204370 2:120226013-120226035 CTCTCACCTCCCACAGCATCTGG No data
937204359_937204370 16 Left 937204359 2:120225974-120225996 CCCTGAGAAACCTCGACCCCTGG No data
Right 937204370 2:120226013-120226035 CTCTCACCTCCCACAGCATCTGG No data
937204363_937204370 6 Left 937204363 2:120225984-120226006 CCTCGACCCCTGGTGGACCAGTG No data
Right 937204370 2:120226013-120226035 CTCTCACCTCCCACAGCATCTGG No data
937204364_937204370 0 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204370 2:120226013-120226035 CTCTCACCTCCCACAGCATCTGG No data
937204366_937204370 -2 Left 937204366 2:120225992-120226014 CCTGGTGGACCAGTGACCCTTCT No data
Right 937204370 2:120226013-120226035 CTCTCACCTCCCACAGCATCTGG No data
937204365_937204370 -1 Left 937204365 2:120225991-120226013 CCCTGGTGGACCAGTGACCCTTC No data
Right 937204370 2:120226013-120226035 CTCTCACCTCCCACAGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937204370 Original CRISPR CTCTCACCTCCCACAGCATC TGG Intergenic