ID: 937204372

View in Genome Browser
Species Human (GRCh38)
Location 2:120226019-120226041
Sequence TGGCACCCAGATGCTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204372_937204385 0 Left 937204372 2:120226019-120226041 CCTCCCACAGCATCTGGGTGCCA No data
Right 937204385 2:120226042-120226064 GAGGTGGGGTAGGGGCAGGCGGG No data
937204372_937204386 1 Left 937204372 2:120226019-120226041 CCTCCCACAGCATCTGGGTGCCA No data
Right 937204386 2:120226043-120226065 AGGTGGGGTAGGGGCAGGCGGGG No data
937204372_937204384 -1 Left 937204372 2:120226019-120226041 CCTCCCACAGCATCTGGGTGCCA No data
Right 937204384 2:120226041-120226063 AGAGGTGGGGTAGGGGCAGGCGG No data
937204372_937204388 20 Left 937204372 2:120226019-120226041 CCTCCCACAGCATCTGGGTGCCA No data
Right 937204388 2:120226062-120226084 GGGGACCTTGTTCCTATCCTGGG No data
937204372_937204380 -9 Left 937204372 2:120226019-120226041 CCTCCCACAGCATCTGGGTGCCA No data
Right 937204380 2:120226033-120226055 TGGGTGCCAGAGGTGGGGTAGGG No data
937204372_937204381 -8 Left 937204372 2:120226019-120226041 CCTCCCACAGCATCTGGGTGCCA No data
Right 937204381 2:120226034-120226056 GGGTGCCAGAGGTGGGGTAGGGG No data
937204372_937204379 -10 Left 937204372 2:120226019-120226041 CCTCCCACAGCATCTGGGTGCCA No data
Right 937204379 2:120226032-120226054 CTGGGTGCCAGAGGTGGGGTAGG No data
937204372_937204387 19 Left 937204372 2:120226019-120226041 CCTCCCACAGCATCTGGGTGCCA No data
Right 937204387 2:120226061-120226083 CGGGGACCTTGTTCCTATCCTGG No data
937204372_937204382 -4 Left 937204372 2:120226019-120226041 CCTCCCACAGCATCTGGGTGCCA No data
Right 937204382 2:120226038-120226060 GCCAGAGGTGGGGTAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937204372 Original CRISPR TGGCACCCAGATGCTGTGGG AGG (reversed) Intergenic