ID: 937204373

View in Genome Browser
Species Human (GRCh38)
Location 2:120226022-120226044
Sequence CTCTGGCACCCAGATGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204373_937204386 -2 Left 937204373 2:120226022-120226044 CCCACAGCATCTGGGTGCCAGAG No data
Right 937204386 2:120226043-120226065 AGGTGGGGTAGGGGCAGGCGGGG No data
937204373_937204385 -3 Left 937204373 2:120226022-120226044 CCCACAGCATCTGGGTGCCAGAG No data
Right 937204385 2:120226042-120226064 GAGGTGGGGTAGGGGCAGGCGGG No data
937204373_937204387 16 Left 937204373 2:120226022-120226044 CCCACAGCATCTGGGTGCCAGAG No data
Right 937204387 2:120226061-120226083 CGGGGACCTTGTTCCTATCCTGG No data
937204373_937204384 -4 Left 937204373 2:120226022-120226044 CCCACAGCATCTGGGTGCCAGAG No data
Right 937204384 2:120226041-120226063 AGAGGTGGGGTAGGGGCAGGCGG No data
937204373_937204388 17 Left 937204373 2:120226022-120226044 CCCACAGCATCTGGGTGCCAGAG No data
Right 937204388 2:120226062-120226084 GGGGACCTTGTTCCTATCCTGGG No data
937204373_937204382 -7 Left 937204373 2:120226022-120226044 CCCACAGCATCTGGGTGCCAGAG No data
Right 937204382 2:120226038-120226060 GCCAGAGGTGGGGTAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937204373 Original CRISPR CTCTGGCACCCAGATGCTGT GGG (reversed) Intergenic
No off target data available for this crispr