ID: 937204374

View in Genome Browser
Species Human (GRCh38)
Location 2:120226023-120226045
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204374_937204385 -4 Left 937204374 2:120226023-120226045 CCACAGCATCTGGGTGCCAGAGG No data
Right 937204385 2:120226042-120226064 GAGGTGGGGTAGGGGCAGGCGGG No data
937204374_937204387 15 Left 937204374 2:120226023-120226045 CCACAGCATCTGGGTGCCAGAGG No data
Right 937204387 2:120226061-120226083 CGGGGACCTTGTTCCTATCCTGG No data
937204374_937204386 -3 Left 937204374 2:120226023-120226045 CCACAGCATCTGGGTGCCAGAGG No data
Right 937204386 2:120226043-120226065 AGGTGGGGTAGGGGCAGGCGGGG No data
937204374_937204384 -5 Left 937204374 2:120226023-120226045 CCACAGCATCTGGGTGCCAGAGG No data
Right 937204384 2:120226041-120226063 AGAGGTGGGGTAGGGGCAGGCGG No data
937204374_937204388 16 Left 937204374 2:120226023-120226045 CCACAGCATCTGGGTGCCAGAGG No data
Right 937204388 2:120226062-120226084 GGGGACCTTGTTCCTATCCTGGG No data
937204374_937204382 -8 Left 937204374 2:120226023-120226045 CCACAGCATCTGGGTGCCAGAGG No data
Right 937204382 2:120226038-120226060 GCCAGAGGTGGGGTAGGGGCAGG No data
937204374_937204391 30 Left 937204374 2:120226023-120226045 CCACAGCATCTGGGTGCCAGAGG No data
Right 937204391 2:120226076-120226098 TATCCTGGGACTCATTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937204374 Original CRISPR CCTCTGGCACCCAGATGCTG TGG (reversed) Intergenic