ID: 937204376

View in Genome Browser
Species Human (GRCh38)
Location 2:120226026-120226048
Sequence CAGCATCTGGGTGCCAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204365_937204376 12 Left 937204365 2:120225991-120226013 CCCTGGTGGACCAGTGACCCTTC No data
Right 937204376 2:120226026-120226048 CAGCATCTGGGTGCCAGAGGTGG No data
937204366_937204376 11 Left 937204366 2:120225992-120226014 CCTGGTGGACCAGTGACCCTTCT No data
Right 937204376 2:120226026-120226048 CAGCATCTGGGTGCCAGAGGTGG No data
937204359_937204376 29 Left 937204359 2:120225974-120225996 CCCTGAGAAACCTCGACCCCTGG No data
Right 937204376 2:120226026-120226048 CAGCATCTGGGTGCCAGAGGTGG No data
937204368_937204376 -5 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204376 2:120226026-120226048 CAGCATCTGGGTGCCAGAGGTGG No data
937204367_937204376 2 Left 937204367 2:120226001-120226023 CCAGTGACCCTTCTCTCACCTCC No data
Right 937204376 2:120226026-120226048 CAGCATCTGGGTGCCAGAGGTGG No data
937204363_937204376 19 Left 937204363 2:120225984-120226006 CCTCGACCCCTGGTGGACCAGTG No data
Right 937204376 2:120226026-120226048 CAGCATCTGGGTGCCAGAGGTGG No data
937204369_937204376 -6 Left 937204369 2:120226009-120226031 CCTTCTCTCACCTCCCACAGCAT No data
Right 937204376 2:120226026-120226048 CAGCATCTGGGTGCCAGAGGTGG No data
937204361_937204376 28 Left 937204361 2:120225975-120225997 CCTGAGAAACCTCGACCCCTGGT No data
Right 937204376 2:120226026-120226048 CAGCATCTGGGTGCCAGAGGTGG No data
937204364_937204376 13 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204376 2:120226026-120226048 CAGCATCTGGGTGCCAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937204376 Original CRISPR CAGCATCTGGGTGCCAGAGG TGG Intergenic