ID: 937204379

View in Genome Browser
Species Human (GRCh38)
Location 2:120226032-120226054
Sequence CTGGGTGCCAGAGGTGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204363_937204379 25 Left 937204363 2:120225984-120226006 CCTCGACCCCTGGTGGACCAGTG No data
Right 937204379 2:120226032-120226054 CTGGGTGCCAGAGGTGGGGTAGG No data
937204367_937204379 8 Left 937204367 2:120226001-120226023 CCAGTGACCCTTCTCTCACCTCC No data
Right 937204379 2:120226032-120226054 CTGGGTGCCAGAGGTGGGGTAGG No data
937204366_937204379 17 Left 937204366 2:120225992-120226014 CCTGGTGGACCAGTGACCCTTCT No data
Right 937204379 2:120226032-120226054 CTGGGTGCCAGAGGTGGGGTAGG No data
937204369_937204379 0 Left 937204369 2:120226009-120226031 CCTTCTCTCACCTCCCACAGCAT No data
Right 937204379 2:120226032-120226054 CTGGGTGCCAGAGGTGGGGTAGG No data
937204372_937204379 -10 Left 937204372 2:120226019-120226041 CCTCCCACAGCATCTGGGTGCCA No data
Right 937204379 2:120226032-120226054 CTGGGTGCCAGAGGTGGGGTAGG No data
937204365_937204379 18 Left 937204365 2:120225991-120226013 CCCTGGTGGACCAGTGACCCTTC No data
Right 937204379 2:120226032-120226054 CTGGGTGCCAGAGGTGGGGTAGG No data
937204368_937204379 1 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204379 2:120226032-120226054 CTGGGTGCCAGAGGTGGGGTAGG No data
937204364_937204379 19 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204379 2:120226032-120226054 CTGGGTGCCAGAGGTGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937204379 Original CRISPR CTGGGTGCCAGAGGTGGGGT AGG Intergenic