ID: 937204380

View in Genome Browser
Species Human (GRCh38)
Location 2:120226033-120226055
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204372_937204380 -9 Left 937204372 2:120226019-120226041 CCTCCCACAGCATCTGGGTGCCA No data
Right 937204380 2:120226033-120226055 TGGGTGCCAGAGGTGGGGTAGGG No data
937204369_937204380 1 Left 937204369 2:120226009-120226031 CCTTCTCTCACCTCCCACAGCAT No data
Right 937204380 2:120226033-120226055 TGGGTGCCAGAGGTGGGGTAGGG No data
937204368_937204380 2 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204380 2:120226033-120226055 TGGGTGCCAGAGGTGGGGTAGGG No data
937204364_937204380 20 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204380 2:120226033-120226055 TGGGTGCCAGAGGTGGGGTAGGG No data
937204367_937204380 9 Left 937204367 2:120226001-120226023 CCAGTGACCCTTCTCTCACCTCC No data
Right 937204380 2:120226033-120226055 TGGGTGCCAGAGGTGGGGTAGGG No data
937204363_937204380 26 Left 937204363 2:120225984-120226006 CCTCGACCCCTGGTGGACCAGTG No data
Right 937204380 2:120226033-120226055 TGGGTGCCAGAGGTGGGGTAGGG No data
937204366_937204380 18 Left 937204366 2:120225992-120226014 CCTGGTGGACCAGTGACCCTTCT No data
Right 937204380 2:120226033-120226055 TGGGTGCCAGAGGTGGGGTAGGG No data
937204365_937204380 19 Left 937204365 2:120225991-120226013 CCCTGGTGGACCAGTGACCCTTC No data
Right 937204380 2:120226033-120226055 TGGGTGCCAGAGGTGGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type