ID: 937204383

View in Genome Browser
Species Human (GRCh38)
Location 2:120226039-120226061
Sequence GCCTGCCCCTACCCCACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204383_937204388 0 Left 937204383 2:120226039-120226061 CCAGAGGTGGGGTAGGGGCAGGC No data
Right 937204388 2:120226062-120226084 GGGGACCTTGTTCCTATCCTGGG No data
937204383_937204391 14 Left 937204383 2:120226039-120226061 CCAGAGGTGGGGTAGGGGCAGGC No data
Right 937204391 2:120226076-120226098 TATCCTGGGACTCATTTCCCTGG No data
937204383_937204387 -1 Left 937204383 2:120226039-120226061 CCAGAGGTGGGGTAGGGGCAGGC No data
Right 937204387 2:120226061-120226083 CGGGGACCTTGTTCCTATCCTGG No data
937204383_937204394 29 Left 937204383 2:120226039-120226061 CCAGAGGTGGGGTAGGGGCAGGC No data
Right 937204394 2:120226091-120226113 TTCCCTGGGTGTTGTCTGTTTGG No data
937204383_937204392 15 Left 937204383 2:120226039-120226061 CCAGAGGTGGGGTAGGGGCAGGC No data
Right 937204392 2:120226077-120226099 ATCCTGGGACTCATTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937204383 Original CRISPR GCCTGCCCCTACCCCACCTC TGG (reversed) Intergenic