ID: 937204384

View in Genome Browser
Species Human (GRCh38)
Location 2:120226041-120226063
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204372_937204384 -1 Left 937204372 2:120226019-120226041 CCTCCCACAGCATCTGGGTGCCA No data
Right 937204384 2:120226041-120226063 AGAGGTGGGGTAGGGGCAGGCGG No data
937204373_937204384 -4 Left 937204373 2:120226022-120226044 CCCACAGCATCTGGGTGCCAGAG No data
Right 937204384 2:120226041-120226063 AGAGGTGGGGTAGGGGCAGGCGG No data
937204365_937204384 27 Left 937204365 2:120225991-120226013 CCCTGGTGGACCAGTGACCCTTC No data
Right 937204384 2:120226041-120226063 AGAGGTGGGGTAGGGGCAGGCGG No data
937204368_937204384 10 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204384 2:120226041-120226063 AGAGGTGGGGTAGGGGCAGGCGG No data
937204367_937204384 17 Left 937204367 2:120226001-120226023 CCAGTGACCCTTCTCTCACCTCC No data
Right 937204384 2:120226041-120226063 AGAGGTGGGGTAGGGGCAGGCGG No data
937204374_937204384 -5 Left 937204374 2:120226023-120226045 CCACAGCATCTGGGTGCCAGAGG No data
Right 937204384 2:120226041-120226063 AGAGGTGGGGTAGGGGCAGGCGG No data
937204366_937204384 26 Left 937204366 2:120225992-120226014 CCTGGTGGACCAGTGACCCTTCT No data
Right 937204384 2:120226041-120226063 AGAGGTGGGGTAGGGGCAGGCGG No data
937204369_937204384 9 Left 937204369 2:120226009-120226031 CCTTCTCTCACCTCCCACAGCAT No data
Right 937204384 2:120226041-120226063 AGAGGTGGGGTAGGGGCAGGCGG No data
937204364_937204384 28 Left 937204364 2:120225990-120226012 CCCCTGGTGGACCAGTGACCCTT No data
Right 937204384 2:120226041-120226063 AGAGGTGGGGTAGGGGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type