ID: 937204387

View in Genome Browser
Species Human (GRCh38)
Location 2:120226061-120226083
Sequence CGGGGACCTTGTTCCTATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204369_937204387 29 Left 937204369 2:120226009-120226031 CCTTCTCTCACCTCCCACAGCAT No data
Right 937204387 2:120226061-120226083 CGGGGACCTTGTTCCTATCCTGG No data
937204383_937204387 -1 Left 937204383 2:120226039-120226061 CCAGAGGTGGGGTAGGGGCAGGC No data
Right 937204387 2:120226061-120226083 CGGGGACCTTGTTCCTATCCTGG No data
937204374_937204387 15 Left 937204374 2:120226023-120226045 CCACAGCATCTGGGTGCCAGAGG No data
Right 937204387 2:120226061-120226083 CGGGGACCTTGTTCCTATCCTGG No data
937204368_937204387 30 Left 937204368 2:120226008-120226030 CCCTTCTCTCACCTCCCACAGCA No data
Right 937204387 2:120226061-120226083 CGGGGACCTTGTTCCTATCCTGG No data
937204372_937204387 19 Left 937204372 2:120226019-120226041 CCTCCCACAGCATCTGGGTGCCA No data
Right 937204387 2:120226061-120226083 CGGGGACCTTGTTCCTATCCTGG No data
937204373_937204387 16 Left 937204373 2:120226022-120226044 CCCACAGCATCTGGGTGCCAGAG No data
Right 937204387 2:120226061-120226083 CGGGGACCTTGTTCCTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937204387 Original CRISPR CGGGGACCTTGTTCCTATCC TGG Intergenic