ID: 937204388

View in Genome Browser
Species Human (GRCh38)
Location 2:120226062-120226084
Sequence GGGGACCTTGTTCCTATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204373_937204388 17 Left 937204373 2:120226022-120226044 CCCACAGCATCTGGGTGCCAGAG No data
Right 937204388 2:120226062-120226084 GGGGACCTTGTTCCTATCCTGGG No data
937204383_937204388 0 Left 937204383 2:120226039-120226061 CCAGAGGTGGGGTAGGGGCAGGC No data
Right 937204388 2:120226062-120226084 GGGGACCTTGTTCCTATCCTGGG No data
937204372_937204388 20 Left 937204372 2:120226019-120226041 CCTCCCACAGCATCTGGGTGCCA No data
Right 937204388 2:120226062-120226084 GGGGACCTTGTTCCTATCCTGGG No data
937204374_937204388 16 Left 937204374 2:120226023-120226045 CCACAGCATCTGGGTGCCAGAGG No data
Right 937204388 2:120226062-120226084 GGGGACCTTGTTCCTATCCTGGG No data
937204369_937204388 30 Left 937204369 2:120226009-120226031 CCTTCTCTCACCTCCCACAGCAT No data
Right 937204388 2:120226062-120226084 GGGGACCTTGTTCCTATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937204388 Original CRISPR GGGGACCTTGTTCCTATCCT GGG Intergenic