ID: 937204528

View in Genome Browser
Species Human (GRCh38)
Location 2:120226972-120226994
Sequence CAGTCAGAGCAGCTGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937204521_937204528 8 Left 937204521 2:120226941-120226963 CCAGGGTGACAGTGACACCTGGG No data
Right 937204528 2:120226972-120226994 CAGTCAGAGCAGCTGGAAGCTGG No data
937204517_937204528 22 Left 937204517 2:120226927-120226949 CCCTCCACAGCAGACCAGGGTGA No data
Right 937204528 2:120226972-120226994 CAGTCAGAGCAGCTGGAAGCTGG No data
937204518_937204528 21 Left 937204518 2:120226928-120226950 CCTCCACAGCAGACCAGGGTGAC No data
Right 937204528 2:120226972-120226994 CAGTCAGAGCAGCTGGAAGCTGG No data
937204514_937204528 29 Left 937204514 2:120226920-120226942 CCTGGCACCCTCCACAGCAGACC No data
Right 937204528 2:120226972-120226994 CAGTCAGAGCAGCTGGAAGCTGG No data
937204524_937204528 -9 Left 937204524 2:120226958-120226980 CCTGGGCATGGTCCCAGTCAGAG No data
Right 937204528 2:120226972-120226994 CAGTCAGAGCAGCTGGAAGCTGG No data
937204519_937204528 18 Left 937204519 2:120226931-120226953 CCACAGCAGACCAGGGTGACAGT No data
Right 937204528 2:120226972-120226994 CAGTCAGAGCAGCTGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937204528 Original CRISPR CAGTCAGAGCAGCTGGAAGC TGG Intergenic
No off target data available for this crispr