ID: 937209880

View in Genome Browser
Species Human (GRCh38)
Location 2:120261619-120261641
Sequence CATGCAAATGCTGCTGTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937209880_937209890 22 Left 937209880 2:120261619-120261641 CCCTCGACAGCAGCATTTGCATG No data
Right 937209890 2:120261664-120261686 GTGAGTGAGATGGAGGGGAAGGG No data
937209880_937209887 16 Left 937209880 2:120261619-120261641 CCCTCGACAGCAGCATTTGCATG No data
Right 937209887 2:120261658-120261680 AAAACAGTGAGTGAGATGGAGGG No data
937209880_937209892 29 Left 937209880 2:120261619-120261641 CCCTCGACAGCAGCATTTGCATG No data
Right 937209892 2:120261671-120261693 AGATGGAGGGGAAGGGAGCAGGG No data
937209880_937209886 15 Left 937209880 2:120261619-120261641 CCCTCGACAGCAGCATTTGCATG No data
Right 937209886 2:120261657-120261679 GAAAACAGTGAGTGAGATGGAGG No data
937209880_937209888 17 Left 937209880 2:120261619-120261641 CCCTCGACAGCAGCATTTGCATG No data
Right 937209888 2:120261659-120261681 AAACAGTGAGTGAGATGGAGGGG No data
937209880_937209889 21 Left 937209880 2:120261619-120261641 CCCTCGACAGCAGCATTTGCATG No data
Right 937209889 2:120261663-120261685 AGTGAGTGAGATGGAGGGGAAGG No data
937209880_937209885 12 Left 937209880 2:120261619-120261641 CCCTCGACAGCAGCATTTGCATG No data
Right 937209885 2:120261654-120261676 GCTGAAAACAGTGAGTGAGATGG No data
937209880_937209891 28 Left 937209880 2:120261619-120261641 CCCTCGACAGCAGCATTTGCATG No data
Right 937209891 2:120261670-120261692 GAGATGGAGGGGAAGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937209880 Original CRISPR CATGCAAATGCTGCTGTCGA GGG (reversed) Intronic
No off target data available for this crispr