ID: 937211330

View in Genome Browser
Species Human (GRCh38)
Location 2:120273690-120273712
Sequence CTGTAAGACCAGAGGCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937211324_937211330 8 Left 937211324 2:120273659-120273681 CCTATGCCCAGGAATAAGAGAAG No data
Right 937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG No data
937211325_937211330 2 Left 937211325 2:120273665-120273687 CCCAGGAATAAGAGAAGACGCCG No data
Right 937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG No data
937211322_937211330 27 Left 937211322 2:120273640-120273662 CCTCTCAGGGTTGGTGTGGCCTA No data
Right 937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG No data
937211326_937211330 1 Left 937211326 2:120273666-120273688 CCAGGAATAAGAGAAGACGCCGA No data
Right 937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937211330 Original CRISPR CTGTAAGACCAGAGGCAAGA TGG Intronic
No off target data available for this crispr