ID: 937213546

View in Genome Browser
Species Human (GRCh38)
Location 2:120295001-120295023
Sequence TACCCACTCTTGACTAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937213546_937213547 -2 Left 937213546 2:120295001-120295023 CCAGTTCTAGTCAAGAGTGGGTA 0: 1
1: 0
2: 0
3: 15
4: 94
Right 937213547 2:120295022-120295044 TAAGTTTGAGCCGATCACAGTGG 0: 1
1: 0
2: 0
3: 9
4: 141
937213546_937213550 29 Left 937213546 2:120295001-120295023 CCAGTTCTAGTCAAGAGTGGGTA 0: 1
1: 0
2: 0
3: 15
4: 94
Right 937213550 2:120295053-120295075 TGTAATTCCAGCACTTTGAGAGG 0: 569
1: 23909
2: 322154
3: 260693
4: 142716

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937213546 Original CRISPR TACCCACTCTTGACTAGAAC TGG (reversed) Intergenic
903465638 1:23550835-23550857 TACCCTCTCTTGAAGAGAATAGG - Intergenic
904444887 1:30562675-30562697 TGCCTAATCTTGCCTAGAACTGG - Intergenic
905988595 1:42312107-42312129 TAGCAACAATTGACTAGAACTGG - Intronic
919473119 1:198003311-198003333 TACCCATTCCTGACTAGAATTGG - Intergenic
922324491 1:224515719-224515741 TACCCAGGCTTGTCTATAACAGG + Intronic
923548582 1:234943054-234943076 TGCCTAATCTTGCCTAGAACTGG - Intergenic
924607448 1:245547205-245547227 TTCCCACTCTTTGCAAGAACGGG - Intronic
1064933026 10:20648858-20648880 TGCCCATTCTTGCCTAGAACTGG + Intergenic
1065156383 10:22874151-22874173 TGCCCAGTCTTGCCTAGAACTGG - Intergenic
1069046885 10:63752421-63752443 TGCCCAATCTTGCCTAGAACTGG - Intergenic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1081480706 11:43485946-43485968 TATCTACTCTAGACTATAACAGG + Intronic
1083350746 11:62027174-62027196 TGCCTAATCTTGCCTAGAACTGG + Intergenic
1084202643 11:67571523-67571545 TGCCTAATCTTGCCTAGAACTGG - Intergenic
1086731211 11:90251787-90251809 TGCCTAATCTTGCCTAGAACTGG - Intergenic
1091466535 12:689587-689609 TGCACAATCTTGCCTAGAACTGG - Intergenic
1098338816 12:69430927-69430949 TACCCACAATTAACTAGACCAGG + Intergenic
1101513975 12:105417695-105417717 TACCCACCCCTGCCTAGAAAAGG - Intergenic
1105949250 13:25214693-25214715 TGACCAATCTTGCCTAGAACTGG - Intergenic
1106131809 13:26947030-26947052 TACCTACGCTTGACCAGAAATGG + Intergenic
1108448916 13:50540441-50540463 TACCTGGTCTTGACTAGAGCAGG - Intronic
1110619239 13:77577165-77577187 AATACTCTCTTGACTAGAACTGG + Intronic
1113513985 13:110876866-110876888 TGCCTAATCTTGCCTAGAACTGG + Intergenic
1113881554 13:113629564-113629586 TACCCACACTTGACTAGAGTGGG + Intronic
1115486333 14:33914588-33914610 AAGCCACACTGGACTAGAACTGG - Intergenic
1121160911 14:91739137-91739159 TAACCAATCTAGACTGGAACAGG + Intronic
1124041295 15:26106949-26106971 TGCCCAGTCTTGCCTAGAAATGG + Intergenic
1124448023 15:29756543-29756565 TCCTCACTGTTGTCTAGAACTGG - Intronic
1128464212 15:67895893-67895915 TGCCCAATCTTGCCTAGAACTGG - Intergenic
1128584102 15:68832459-68832481 TACTCAATCGTGACTAGAACTGG - Intronic
1130424910 15:83787148-83787170 TTCTCACTCTTTACTAGGACAGG + Intronic
1132499498 16:279052-279074 TGCCCAATCCTGCCTAGAACTGG - Intronic
1134780511 16:16891037-16891059 TGCCCAGTCTTGCCTAGAACTGG - Intergenic
1135234825 16:20745374-20745396 TACCCAGTCTGGTCTTGAACTGG - Intronic
1136913213 16:34160519-34160541 TACCCACTCCTGACTCGAGGAGG + Intergenic
1138873196 16:60917731-60917753 TGCCCACCCTTCACTAGAACAGG - Intergenic
1145262972 17:21365622-21365644 TGCCAACTCTTGTCTAGATCTGG - Intergenic
1146206074 17:30906524-30906546 TACCCACTACAGACTAAAACTGG - Exonic
1149285856 17:55163814-55163836 TAACACCTCTTGACTAGAAAAGG + Exonic
1151490422 17:74429809-74429831 TCCCCACTCTGGACCAGCACAGG + Intronic
1152233670 17:79127285-79127307 TACCCACTCTGCTCTTGAACTGG - Intronic
1158793481 18:60811904-60811926 AACCCTCTCTTGTCTTGAACTGG - Intergenic
1158811475 18:61042055-61042077 GATCCACTATTGAATAGAACTGG + Intergenic
1162851959 19:13437836-13437858 TACCCACTCCTGATCAGAGCTGG - Intronic
1165182066 19:33979925-33979947 GACCCACTCTGGACTAGGAGAGG - Intergenic
1167222120 19:48206475-48206497 TGCCCAATCTTGCCTAGAACTGG - Intronic
1168425258 19:56234974-56234996 TGCCTAATCTTGCCTAGAACTGG - Intronic
930091068 2:47531754-47531776 TGCCTAATCTTGCCTAGAACTGG - Intronic
930531961 2:52599373-52599395 CATCCACTCTTGAGTAGACCAGG + Intergenic
937213546 2:120295001-120295023 TACCCACTCTTGACTAGAACTGG - Intergenic
937906467 2:127055136-127055158 TACACACTCTTGACAGGCACCGG + Intronic
943010804 2:182446463-182446485 TAGCCACTCCTGACCAAAACAGG - Intronic
945999649 2:216470693-216470715 TGCCCAGGCTTGTCTAGAACTGG + Intronic
1172709098 20:36906515-36906537 TACCCACTCTTGTCAAACACTGG - Intronic
1179551833 21:42148344-42148366 TGCCTAATCTTGCCTAGAACTGG + Intergenic
1182988498 22:34743725-34743747 TGCCTACTCTAGACTGGAACTGG + Intergenic
1183751686 22:39724487-39724509 TGCCCAATCTTGCCTAGAACTGG - Intergenic
1183864370 22:40692608-40692630 AGCCCAGTCTTGCCTAGAACTGG + Intergenic
950229926 3:11267614-11267636 TGCCAACTCTTGACTATATCAGG - Intergenic
952166113 3:30751099-30751121 TGCCCAATCTTGCCTAGAACTGG - Intronic
954284287 3:49607845-49607867 GACCCACCCTTGACGAGAAGAGG - Intronic
959643458 3:108668500-108668522 TGCCCACTCTAAACTAGAGCTGG + Intronic
959690561 3:109193085-109193107 AGCCCAGTCTTGCCTAGAACTGG - Intergenic
961972845 3:130988752-130988774 TGCCTAATCTTGCCTAGAACTGG - Intronic
969427433 4:7133582-7133604 TACCCACTCTTCACTGGCATTGG - Intergenic
969614578 4:8244838-8244860 TGCCCAATCCTGCCTAGAACTGG - Intergenic
970422198 4:15915791-15915813 TGCCCAATTTTGCCTAGAACTGG + Intergenic
974201175 4:58642795-58642817 TACCCACTATTGAATAGAGAAGG + Intergenic
974227359 4:59064186-59064208 GAGCCATTCTTGACTACAACAGG + Intergenic
981094556 4:140764883-140764905 TGCCCTATCTTGCCTAGAACTGG - Intergenic
983371993 4:166871973-166871995 TACCCACTCTTGACAAAACAAGG + Intronic
990525177 5:56618412-56618434 TGCCTAATCTTGCCTAGAACTGG + Intergenic
992449390 5:76862328-76862350 TGCCCAATCTTGCCTAGAACTGG - Intronic
993717226 5:91287632-91287654 CACCCACTTTTGCTTAGAACTGG - Intergenic
994753716 5:103769351-103769373 GAGCCACTCTTGGCTAAAACAGG + Intergenic
995593101 5:113720553-113720575 TACCACCTCTAGACCAGAACAGG + Intergenic
995623585 5:114054287-114054309 TACTCTCTCTTTACTAGAGCAGG + Intergenic
1001969956 5:175947552-175947574 CAACCCCTCTTGACTATAACTGG + Intronic
1002247481 5:177896212-177896234 CAACCCCTCTTGACTATAACTGG - Intergenic
1003469150 6:6412443-6412465 CACCGAATCTTGCCTAGAACTGG - Intergenic
1007793097 6:44325001-44325023 TACACACTCTTGACCAGACAAGG - Intronic
1007820306 6:44555918-44555940 TACCCCCTCTTGCCCAGATCTGG - Intergenic
1008594659 6:53029389-53029411 TAGAAACTTTTGACTAGAACTGG + Intronic
1012532811 6:100258949-100258971 TAACCACTCTTCACTAGCACAGG + Intergenic
1014236367 6:118960319-118960341 TACCCCCTCTATACTAGAATCGG + Intronic
1017947400 6:159106813-159106835 TGCCTAATCTTGCCTAGAACTGG - Intergenic
1020177869 7:5897485-5897507 TGCCTAATCTTGCCTAGAACTGG - Intergenic
1020305045 7:6827489-6827511 TGCCTAATCTTGCCTAGAACTGG + Intergenic
1021697011 7:23285722-23285744 TGCCTAATCTTGCCTAGAACTGG - Intergenic
1026684001 7:72492689-72492711 TACCCACTCTTATCTGGACCTGG + Intergenic
1029080975 7:97973576-97973598 TGCCTAATCTTGCCTAGAACTGG + Intergenic
1029407875 7:100387763-100387785 TACCCACTCGTGACTGCAGCTGG + Intronic
1031785399 7:126024850-126024872 TAGCCACTTATGACTAAAACTGG + Intergenic
1031942334 7:127802183-127802205 TGCCTACTGTTGACCAGAACAGG + Intronic
1034100126 7:148443831-148443853 TTCCCACTCTTCCCTTGAACTGG + Intergenic
1035070615 7:156142460-156142482 TAACCTGTCTTGACCAGAACCGG + Intergenic
1037094111 8:14962940-14962962 GACCTACTTTTTACTAGAACAGG - Intronic
1038522505 8:28245285-28245307 TGCCCAGTCTTGCCTGGAACTGG - Intergenic
1039485420 8:37906070-37906092 TGCCTAATCTTGCCTAGAACTGG + Intergenic
1041313203 8:56537135-56537157 TGCTCACTCTTCACTAGACCTGG + Intergenic
1044068879 8:87730652-87730674 TAACAACTTTTGATTAGAACTGG - Intergenic
1045057767 8:98384095-98384117 TGCCTAATCTTGCCTAGAACTGG - Intergenic
1045058565 8:98391768-98391790 TACTCCATCTTAACTAGAACCGG + Intergenic
1045497541 8:102720984-102721006 TCCCCAAGCTTGACTAGAAATGG - Intergenic
1051154778 9:14129423-14129445 CACCCTCTCTAGACTAGAAGGGG + Intronic
1058438130 9:104982707-104982729 TGCCTAATCTTGCCTAGAACTGG - Intergenic
1061796668 9:133089392-133089414 TCCCCAATCCTGCCTAGAACTGG - Intergenic
1188196094 X:27236475-27236497 CACCCACTTTTGAGTAGAACTGG + Intergenic
1198642691 X:138774132-138774154 TACCCATTCTTCACAGGAACTGG + Intronic