ID: 937218064

View in Genome Browser
Species Human (GRCh38)
Location 2:120325163-120325185
Sequence CAGCTGTTGTGCAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937218058_937218064 -1 Left 937218058 2:120325141-120325163 CCCTGCTCTCTCAGCCTCACAAC No data
Right 937218064 2:120325163-120325185 CAGCTGTTGTGCAGGGAGAAGGG No data
937218059_937218064 -2 Left 937218059 2:120325142-120325164 CCTGCTCTCTCAGCCTCACAACA No data
Right 937218064 2:120325163-120325185 CAGCTGTTGTGCAGGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937218064 Original CRISPR CAGCTGTTGTGCAGGGAGAA GGG Intergenic
No off target data available for this crispr