ID: 937219436

View in Genome Browser
Species Human (GRCh38)
Location 2:120333308-120333330
Sequence CTGCTGAAGAGGTAGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937219436_937219440 -2 Left 937219436 2:120333308-120333330 CCATCCAACTACCTCTTCAGCAG No data
Right 937219440 2:120333329-120333351 AGTTGCCCTTGGCACCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937219436 Original CRISPR CTGCTGAAGAGGTAGTTGGA TGG (reversed) Intergenic
No off target data available for this crispr