ID: 937221692

View in Genome Browser
Species Human (GRCh38)
Location 2:120345966-120345988
Sequence GCGCCCCTTCCCTGCCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 276}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937221681_937221692 1 Left 937221681 2:120345942-120345964 CCCCTCGGGCCCCCGGGGCCCTC 0: 1
1: 1
2: 3
3: 39
4: 342
Right 937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG 0: 1
1: 0
2: 0
3: 28
4: 276
937221683_937221692 -1 Left 937221683 2:120345944-120345966 CCTCGGGCCCCCGGGGCCCTCGG 0: 1
1: 1
2: 2
3: 34
4: 437
Right 937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG 0: 1
1: 0
2: 0
3: 28
4: 276
937221669_937221692 21 Left 937221669 2:120345922-120345944 CCTCCGCCCCGCCCGGCGCGCCC 0: 1
1: 2
2: 35
3: 262
4: 1670
Right 937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG 0: 1
1: 0
2: 0
3: 28
4: 276
937221686_937221692 -9 Left 937221686 2:120345952-120345974 CCCCGGGGCCCTCGGCGCCCCTT 0: 1
1: 0
2: 0
3: 23
4: 204
Right 937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG 0: 1
1: 0
2: 0
3: 28
4: 276
937221682_937221692 0 Left 937221682 2:120345943-120345965 CCCTCGGGCCCCCGGGGCCCTCG 0: 1
1: 0
2: 2
3: 13
4: 212
Right 937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG 0: 1
1: 0
2: 0
3: 28
4: 276
937221687_937221692 -10 Left 937221687 2:120345953-120345975 CCCGGGGCCCTCGGCGCCCCTTC 0: 1
1: 0
2: 1
3: 28
4: 300
Right 937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG 0: 1
1: 0
2: 0
3: 28
4: 276
937221670_937221692 18 Left 937221670 2:120345925-120345947 CCGCCCCGCCCGGCGCGCCCCTC 0: 1
1: 2
2: 16
3: 153
4: 1418
Right 937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG 0: 1
1: 0
2: 0
3: 28
4: 276
937221666_937221692 28 Left 937221666 2:120345915-120345937 CCCGCGACCTCCGCCCCGCCCGG 0: 1
1: 0
2: 2
3: 51
4: 486
Right 937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG 0: 1
1: 0
2: 0
3: 28
4: 276
937221674_937221692 14 Left 937221674 2:120345929-120345951 CCCGCCCGGCGCGCCCCTCGGGC 0: 1
1: 0
2: 2
3: 48
4: 407
Right 937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG 0: 1
1: 0
2: 0
3: 28
4: 276
937221676_937221692 10 Left 937221676 2:120345933-120345955 CCCGGCGCGCCCCTCGGGCCCCC 0: 1
1: 0
2: 3
3: 41
4: 446
Right 937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG 0: 1
1: 0
2: 0
3: 28
4: 276
937221668_937221692 27 Left 937221668 2:120345916-120345938 CCGCGACCTCCGCCCCGCCCGGC 0: 1
1: 0
2: 4
3: 95
4: 804
Right 937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG 0: 1
1: 0
2: 0
3: 28
4: 276
937221677_937221692 9 Left 937221677 2:120345934-120345956 CCGGCGCGCCCCTCGGGCCCCCG 0: 1
1: 0
2: 3
3: 60
4: 399
Right 937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG 0: 1
1: 0
2: 0
3: 28
4: 276
937221675_937221692 13 Left 937221675 2:120345930-120345952 CCGCCCGGCGCGCCCCTCGGGCC 0: 1
1: 0
2: 3
3: 48
4: 342
Right 937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG 0: 1
1: 0
2: 0
3: 28
4: 276
937221685_937221692 -8 Left 937221685 2:120345951-120345973 CCCCCGGGGCCCTCGGCGCCCCT 0: 1
1: 0
2: 2
3: 27
4: 331
Right 937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG 0: 1
1: 0
2: 0
3: 28
4: 276
937221672_937221692 15 Left 937221672 2:120345928-120345950 CCCCGCCCGGCGCGCCCCTCGGG 0: 1
1: 0
2: 8
3: 49
4: 365
Right 937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG 0: 1
1: 0
2: 0
3: 28
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937221692 Original CRISPR GCGCCCCTTCCCTGCCGCGC GGG Intergenic
900113550 1:1019604-1019626 GCGCCCCTCCCCCGCGGGGCCGG - Intergenic
900349379 1:2227613-2227635 GGGCGCCTTCCCAGCGGCGCAGG + Intergenic
900437084 1:2635849-2635871 GGGCCCCTTCCCTCCTGCCCTGG - Intergenic
900557348 1:3287214-3287236 GCTCCACTTCCCAGCCACGCGGG + Intronic
900989632 1:6092377-6092399 GCGCCCCTTCCATGCAGTGATGG - Intronic
901025842 1:6278337-6278359 GTGACCCTTCCCTGCAGCCCAGG - Intronic
901100495 1:6715448-6715470 GCGCCCCTCACCTGCCGGACGGG + Intergenic
901855757 1:12043270-12043292 GCGCCTCTGCCCTGCCGCCCCGG + Intergenic
902062623 1:13658213-13658235 GCGCCCCTCACCTGCCGGACGGG - Intergenic
902336207 1:15756416-15756438 CCACCCCTTCCCTGCCACTCAGG + Intergenic
902585711 1:17437883-17437905 GCGCCCCTCCCCCCCCGCCCCGG - Intronic
902706386 1:18208163-18208185 GGGCCCCTTCCCTTCCTCCCAGG - Intronic
902823110 1:18955637-18955659 CCGCCCCTCCCCCGCCGCCCTGG - Intronic
903639412 1:24848335-24848357 GGGTCCCTGCCCTGCCCCGCCGG - Intergenic
903925232 1:26826926-26826948 CCGCCCCCGCCCCGCCGCGCTGG + Exonic
903957138 1:27033309-27033331 TCTCCCCTTCCCTGCTGGGCGGG - Intergenic
904251892 1:29230971-29230993 GCGCCCCGCCCCTGCCCCGCCGG + Intergenic
905427430 1:37896502-37896524 GCGCCCCTCACCTGCCGGACGGG - Intronic
905599025 1:39234376-39234398 GCGCCCCTCACCTTCCGGGCGGG + Intronic
905685003 1:39901708-39901730 GCGCCCCCGCCCGGCCCCGCCGG - Intronic
906211472 1:44014568-44014590 CCACCCCTTCCCTGCCTAGCTGG + Intronic
908468103 1:64415626-64415648 GCGCCCCTTACCTCCCGGACGGG - Intergenic
908468178 1:64415802-64415824 GCGCCCCTTACCTCCCGGACGGG - Intergenic
914703017 1:150150604-150150626 CCGCCCCGTCCTCGCCGCGCGGG - Intronic
914755088 1:150557913-150557935 CCGCCTCTTCCCTGCCCTGCTGG + Intronic
914893729 1:151651188-151651210 GCGCCCCTCACCTCCCGGGCGGG + Intronic
915947243 1:160162487-160162509 GCGCCCCCTCCCTGCTTTGCTGG - Intronic
916792449 1:168136482-168136504 GCGCCCCTCCCCTGCGGCCTGGG - Intronic
917141630 1:171841452-171841474 ACGCCCCTGCCCGCCCGCGCAGG + Intergenic
917876793 1:179293656-179293678 CCGCCCCTTCCCGGGCGCGCGGG - Intergenic
921781744 1:219173840-219173862 CCGCCCCTGCGTTGCCGCGCGGG - Exonic
922616213 1:226962691-226962713 CAGGCCCTTCCCTGCCGCTCTGG + Intronic
922693109 1:227710892-227710914 GCGCCCCTCACCTGCCGGACGGG + Intergenic
923565660 1:235074105-235074127 GAGCTCCTGCCCTGCCGGGCGGG + Intergenic
1067026593 10:42847743-42847765 GCGCCCCTCACCTCCCGGGCGGG - Intergenic
1068721583 10:60251878-60251900 GAGCCCCTTCCCCACCGGGCTGG + Intronic
1070683988 10:78468515-78468537 GCGCCCCTCACCTCCCGGGCAGG + Intergenic
1072180621 10:92976081-92976103 GCGCCCCTCACCTCCCGGGCGGG - Intronic
1073292759 10:102421486-102421508 GCGTCGCTTCGATGCCGCGCAGG + Exonic
1073325578 10:102642696-102642718 GCGCCCTTTCCTCCCCGCGCGGG + Intergenic
1074788555 10:116863741-116863763 GGGCCCCTCCCCTGCCGCGATGG + Intronic
1075139476 10:119818551-119818573 GCGCCCCTCCCCCGCCGGGCCGG + Intronic
1076556011 10:131321984-131322006 CCGCCCCTTCCCTGCCTGTCGGG + Intergenic
1077392632 11:2307145-2307167 GCGCCCTGTCCCTGCAGGGCTGG + Intronic
1079603714 11:22341506-22341528 TCGCCCCTGCTCTGCCGCGCAGG + Exonic
1080387741 11:31819611-31819633 GCATCCCTTCCCAGCCGAGCAGG - Intronic
1080641227 11:34159707-34159729 GCCCCCCTTTCCTGCTGCCCTGG + Intronic
1081845793 11:46239305-46239327 GCGCCCTCTGCCGGCCGCGCGGG - Intergenic
1082746542 11:56968901-56968923 GCTACCCTTCCCTGCCTCCCAGG + Intergenic
1083030200 11:59585272-59585294 CCGCCTCTGCCCTGCCGCCCCGG + Intronic
1083340415 11:61955461-61955483 GACCCCCTCCCCTCCCGCGCAGG - Intronic
1083570981 11:63762421-63762443 GGGCCCCATCCCTGCCACACAGG + Exonic
1083596248 11:63919416-63919438 GCACCCCCTCCCTGCCGCCCCGG + Intergenic
1083739591 11:64701807-64701829 GCGCCCCTCACCTGCCGGACGGG - Intronic
1084072405 11:66744880-66744902 CCGTCCCCTCCATGCCGCGCAGG - Intronic
1084171163 11:67401661-67401683 GCGCCACTTCCGGGCCGGGCAGG + Intronic
1084480900 11:69419473-69419495 GAGCCCCTTCCCTGCTGCAGGGG + Intergenic
1085050176 11:73376366-73376388 GCGCACCTTCCCGGCCCAGCCGG + Exonic
1086122650 11:83317157-83317179 GCGCCTCTGCCCTGCCGCCCCGG - Intergenic
1088658849 11:112026901-112026923 GCGCCCCTCACCTCCCGGGCGGG + Intronic
1088971817 11:114780584-114780606 GGGCCACTTCCCTGCTGGGCTGG - Intergenic
1089198211 11:116707663-116707685 GCGCCCCTTTCCCCTCGCGCGGG - Intergenic
1089341299 11:117759609-117759631 GCCACCCATCCCTGCCCCGCAGG + Intronic
1089729495 11:120511606-120511628 GCGCCCCTTCGGGGCCGGGCCGG - Intergenic
1090202516 11:124866453-124866475 GCGCCCCCTGCCTGCCGCATCGG + Intronic
1090664441 11:128905448-128905470 GCTCCCGGTTCCTGCCGCGCTGG + Intronic
1091730622 12:2877428-2877450 GCCCGCTTTTCCTGCCGCGCTGG + Intronic
1091807402 12:3366165-3366187 CCGCCCCTTCCTTGCCGGCCGGG + Intergenic
1092258928 12:6942081-6942103 CCGCCCCTCCCCTGCCCCGTTGG + Exonic
1092537863 12:9404285-9404307 GCTCTCCGTCCCTGCCTCGCGGG - Intergenic
1092538674 12:9406669-9406691 GCTCTCCGTCCCTGCCTCGCGGG - Intergenic
1093232402 12:16563048-16563070 ACGCACTTTCCCTGCCTCGCTGG + Intronic
1094841454 12:34344241-34344263 CCGACCCTGCTCTGCCGCGCCGG + Intergenic
1096156764 12:49345477-49345499 CCGCCCCTTCCCGGCCGGCCCGG - Intergenic
1096167322 12:49436483-49436505 GCGCCCCTTACCTCCCGGACGGG + Intronic
1096782818 12:54000755-54000777 CCTCCCCTCCCCTCCCGCGCCGG - Intronic
1099255455 12:80308004-80308026 GCGCCCCTCACCTGCCGGACGGG + Intronic
1101781574 12:107843378-107843400 GCGCCCCTGTCCTTCCGTGCAGG - Intergenic
1102933366 12:116878938-116878960 GCCGCCCTCCCCTGCAGCGCAGG + Intronic
1103509977 12:121467397-121467419 GCGCCCCGGCCCTCCCCCGCCGG - Intronic
1103933603 12:124463599-124463621 ACGCAGCTTCCCTGCCGGGCAGG - Intronic
1105248544 13:18674114-18674136 GCGCCCCTCACCTCCCGGGCGGG - Intergenic
1105526929 13:21186303-21186325 GCGCCCCTCACCTCCCGGGCGGG + Intergenic
1105976773 13:25480253-25480275 GCGCCCCTTACCTCCCGGACGGG + Intronic
1106242007 13:27920279-27920301 GCACCCGTTCCCTGGCGCCCTGG + Exonic
1106602564 13:31200249-31200271 GCGGCCCAGCCCTGCCCCGCCGG + Intronic
1113651629 13:112037354-112037376 GCTCCCCTTCCCTGCTGCTGAGG + Intergenic
1114621639 14:24099571-24099593 GCGCTTCTTCCCTGCAGGGCTGG - Exonic
1115688837 14:35824541-35824563 GCGCCCCTCACCTCCCGGGCGGG + Intergenic
1117277444 14:54204310-54204332 GCGCCCCTCACCTCCCGGGCAGG - Intergenic
1118285293 14:64465459-64465481 GCGCCCCCTCCCCACCGCGCGGG - Intronic
1119432163 14:74575564-74575586 GCGTCCCTCCCCTGCCTGGCTGG + Intronic
1122710281 14:103651756-103651778 GCTCCCCTTTGCTGCCGGGCTGG + Intronic
1123036510 14:105474066-105474088 CCGCCCCTTCCCTGCCTGGGAGG + Intronic
1123135779 14:106026474-106026496 GAGCCCCTTCCCTGGAGCTCCGG + Intergenic
1123161019 14:106277940-106277962 GAGCCCCTTCCCTGGAGCTCCGG + Intergenic
1124118455 15:26868072-26868094 GCCCACCTGCCCTGGCGCGCCGG + Intronic
1126849911 15:52790498-52790520 CAGCGCCTTCCCTGCGGCGCTGG + Intronic
1127867173 15:63042455-63042477 ACGCCCTCTCCCTGGCGCGCAGG + Intergenic
1128582336 15:68818763-68818785 GCGCCCTTCCCCCTCCGCGCAGG + Intronic
1128635287 15:69298881-69298903 CCGCCCGTCCCCTCCCGCGCGGG - Intergenic
1128970629 15:72101896-72101918 GCGCCCCTCACCTCCCGGGCGGG - Intronic
1129431775 15:75504703-75504725 GCGCCCCTCACCTCCCGGGCGGG - Intronic
1129685753 15:77685213-77685235 TCACCCCTTCCCTGCTGGGCTGG - Intronic
1130363016 15:83207909-83207931 CCTCCCCTTCCCTCCCGCGCGGG + Exonic
1131837984 15:96409417-96409439 GCTCCCCGGCCCTGCCCCGCCGG - Intergenic
1131977608 15:97961353-97961375 GCGCCCCGCCCCTGGCCCGCCGG + Intronic
1132621152 16:868821-868843 GCGCCCCTTCCCTCCCGCAGAGG - Intronic
1132699283 16:1215467-1215489 GCGGACCCTCCCTGCTGCGCGGG - Intronic
1132734718 16:1379692-1379714 GCGCCCCGCCCCCTCCGCGCTGG + Intronic
1132845490 16:1999205-1999227 CCACCCCTTCCCTGCAGGGCAGG + Intronic
1133241291 16:4416061-4416083 GCTCCTCCTCCCTGCCGCCCCGG - Intronic
1136202245 16:28697954-28697976 GCGCCCCTCACCTCCCGGGCGGG + Intronic
1136426392 16:30170357-30170379 GCGCCCCTCACCTCCCGGGCGGG - Intergenic
1138651552 16:58464012-58464034 CCTCGCCTTCCCGGCCGCGCTGG + Exonic
1139528090 16:67528768-67528790 CCGCCCCTCCCCTGGCCCGCCGG - Intronic
1139623103 16:68163324-68163346 GCGCCCCTCACCTCCCGGGCGGG + Intronic
1139623153 16:68163451-68163473 GCGCCCCTCACCTCCCGGGCGGG + Intronic
1139968225 16:70757352-70757374 GCGCCACTTCCCCGACTCGCAGG - Intronic
1141079129 16:81035734-81035756 GCGCCCCCTGCCGGCCGCGGAGG - Intergenic
1141836077 16:86540519-86540541 GGGCCCCTTCTATGACGCGCAGG + Intronic
1141973368 16:87497124-87497146 GAGACAATTCCCTGCCGCGCCGG - Intergenic
1141992717 16:87619828-87619850 GCGCCCCATCCGTGCCCCGCAGG - Intronic
1142017193 16:87755937-87755959 GCTCACCTTCCCTGCAGCCCGGG - Intronic
1142332440 16:89463081-89463103 GCGCCCCTCACCTCCCGGGCGGG - Intronic
1142533777 17:599159-599181 GCGCCCCTCACCTCCCGGGCGGG - Intronic
1142757746 17:2025648-2025670 ACGCCCCTCCCCGGCCCCGCAGG + Intergenic
1143689700 17:8550548-8550570 GCGCCCCTCACCTCCCGGGCAGG - Intronic
1143757206 17:9075771-9075793 CTGCCTCTTCCCTGCAGCGCTGG - Intronic
1145231253 17:21174928-21174950 GCGCCCCAACCCTGCCTCCCTGG - Intronic
1146938064 17:36824869-36824891 AGGCCCCTTCCCAGCCGGGCTGG + Intergenic
1147562149 17:41515850-41515872 GCGCCCCATCCCAGCCTCTCGGG - Intronic
1147967062 17:44199367-44199389 GCGCCCCTTCCCCTCCCCCCGGG - Intronic
1148404462 17:47398269-47398291 GCGCCCCTCACCTCCCGGGCGGG - Intronic
1148406599 17:47421052-47421074 GCGCCCCTCACCTCCCGGGCGGG - Intronic
1149610359 17:57954879-57954901 GTCTCCCTTCCCTGCGGCGCTGG + Intronic
1149665314 17:58360980-58361002 GCTCCCCTTCCCTCCCTCTCTGG + Intronic
1151849964 17:76684469-76684491 GCACCCCTTCCCCGCCCAGCAGG + Intronic
1151876217 17:76869411-76869433 GCGCCCCTTCCCAGCCCCTCAGG + Intronic
1151966966 17:77436602-77436624 TCGCCCCTCTCCTGCCCCGCTGG + Intronic
1155221564 18:23690008-23690030 GCGCCTTTTCCTTCCCGCGCCGG + Intronic
1157794069 18:50559542-50559564 GTGCCCCTTCCCGCGCGCGCGGG + Intergenic
1159340398 18:67126773-67126795 GCGCCCCTCACCTCCCGGGCGGG + Intergenic
1160013763 18:75125647-75125669 GAGCCCCTGCCCGGCCGCCCTGG - Intergenic
1160025474 18:75211932-75211954 GCGCCCACTCCCCGCGGCGCGGG - Intronic
1160766660 19:811723-811745 CCGCCCCTTCCCTGAAGCTCAGG - Exonic
1160946288 19:1645468-1645490 GCGCCCCTAGCCCGCCCCGCCGG + Intronic
1160961856 19:1725702-1725724 GAGCCCCCTCCGGGCCGCGCGGG + Intergenic
1161048880 19:2151584-2151606 GCGCCCGGTCCCAGCCGAGCCGG + Intronic
1161108751 19:2456845-2456867 ACGCCGCTGCCCGGCCGCGCGGG - Exonic
1162100449 19:8335582-8335604 GCGCCCCGGCCCGGCCTCGCGGG - Exonic
1162141003 19:8585563-8585585 GCGCCGCGTCTCTGCCGCGGAGG - Exonic
1166288182 19:41845228-41845250 TCTCCCCTTCCCTGCCTCGCGGG + Intronic
1166437089 19:42776777-42776799 GGGACCCTTCCCTGCCTGGCAGG + Intronic
1166453735 19:42922890-42922912 GGGGCCCTTCCCTGCCTGGCAGG + Intronic
1166876634 19:45901820-45901842 GCGCCCTTTGCCCGCAGCGCCGG - Exonic
1166942550 19:46375582-46375604 ACGCCCCTTCCCTCCCACCCAGG + Exonic
1166965448 19:46527072-46527094 ACGCCCCTTCCCTCCCACCCAGG - Exonic
1168072967 19:53963008-53963030 GCCCCCCTCCCCAGCCCCGCCGG + Intergenic
926066328 2:9843398-9843420 GCGCGGTTTCCCTGCCGCGCAGG + Exonic
929650723 2:43677785-43677807 GCGCCCCTCACCTCCCGCACCGG + Intronic
931584280 2:63809193-63809215 GCGCCCCTCACCTCCCGGGCGGG - Intronic
931695177 2:64865732-64865754 GCGCCCCCTGGCGGCCGCGCGGG + Intergenic
932338365 2:70943760-70943782 GCGCCTCTCCCCTGCCCTGCAGG + Intronic
934902035 2:98167131-98167153 CCGCCCCTTCCCTGTCCCGCTGG - Intronic
935371806 2:102355746-102355768 GCGCCCCCTTCCGGCCCCGCAGG + Intronic
936078968 2:109419314-109419336 GAGCCCCTTCCCAGCAGCTCAGG - Intronic
936530951 2:113277079-113277101 GCTCCCCAACCCCGCCGCGCCGG + Intronic
937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG + Intergenic
938015427 2:127863316-127863338 GCGGCCCTTCACTGCTGTGCTGG - Exonic
946422214 2:219571303-219571325 GCGCCCCGACCCCGCCGCCCCGG - Intronic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
1168760643 20:347582-347604 GCGCCCCTTCTCCCCCGCCCGGG + Intronic
1169486917 20:6041774-6041796 GGGCCCCTTCCCTACCTCGTGGG - Exonic
1169718341 20:8644735-8644757 GCGCCCCTCACCTCCCGGGCGGG - Intronic
1170756693 20:19212140-19212162 GCGCCCCCTCCCCGCCATGCCGG + Intergenic
1170849361 20:19990338-19990360 GTGCCGCTTCCCTTCCGGGCCGG + Intronic
1171333018 20:24357933-24357955 GCTCCCCTTCCCTGAGGCCCAGG + Intergenic
1172091658 20:32436953-32436975 GAGCCCCTTCCCTGGCTCTCGGG - Exonic
1172209255 20:33185554-33185576 GCGCCTCTGCCCCGCCGCCCCGG - Intergenic
1173306832 20:41858492-41858514 GAGCCCCTTCCCTGCTTCCCTGG - Intergenic
1175085900 20:56458657-56458679 GTACCCCAGCCCTGCCGCGCTGG + Exonic
1175439486 20:58981004-58981026 CAGCCCCTCCCCTGCGGCGCCGG - Intergenic
1175731605 20:61358048-61358070 GCGCTCCTTCCCTGTCGCTCTGG + Intronic
1176222593 20:63977137-63977159 ACGCCCCTCCCCTGCAGGGCCGG - Exonic
1176242013 20:64079680-64079702 GCGCCCCCTCCCCCACGCGCGGG + Intronic
1176386647 21:6141329-6141351 GCGCCGCTCCCAGGCCGCGCAGG - Intergenic
1178555692 21:33588455-33588477 TCGCCCTTTCCCTGCTGCGGGGG - Exonic
1178843577 21:36156784-36156806 GCGGCTCTTCCCCACCGCGCGGG - Intronic
1179225002 21:39445505-39445527 GCGCCCGGTCACTGCCGAGCCGG + Exonic
1179736826 21:43396923-43396945 GCGCCGCTCCCAGGCCGCGCAGG + Intergenic
1180791632 22:18578127-18578149 GCACCCCTTCCCCACGGCGCCGG - Intergenic
1180898499 22:19354253-19354275 GCGCCCCTGCACTTCCGCACAGG + Intronic
1181013948 22:20057592-20057614 GGGCCACATCCCTGCCTCGCTGG - Intronic
1181026536 22:20130849-20130871 GCGGCCCTACCCTGCGGCACAGG - Intronic
1183617376 22:38953903-38953925 GGGCTCCTTCTCTGCCCCGCGGG + Intronic
1183932135 22:41241143-41241165 GTGCCCCCTCCCTGTCGGGCTGG - Intergenic
1184265258 22:43342995-43343017 GCGCCCCCTCCCCGCAGCCCGGG - Intronic
1184669085 22:46003456-46003478 GCGCCCACTCCCTGCCGGCCAGG - Intergenic
1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG + Intergenic
1185294167 22:50045249-50045271 GCGCACCTTGCCTGCTGCTCAGG + Exonic
949562914 3:5219413-5219435 GTGCCTCTTCCCTGCAGGGCAGG + Exonic
950054068 3:10011404-10011426 GGGCCACTTCCCTGCGGGGCGGG + Intergenic
950412664 3:12849614-12849636 GCGCCCCTCACCTCCCGGGCGGG + Intronic
953426418 3:42798695-42798717 GCGCCCCTCACCTCCCGGGCGGG - Intronic
953706447 3:45234657-45234679 GTGCCCTTTCCCTGCTGCCCAGG + Intergenic
953959559 3:47256550-47256572 GCGCCCCTCCCCTCCCGGACAGG - Intronic
955674318 3:61434380-61434402 GCGCCCCTCACCTCCCGGGCGGG + Intergenic
959530808 3:107431787-107431809 GAGCCCCTTGCCAGGCGCGCAGG + Intergenic
960994005 3:123329319-123329341 GCTCCCCTTCCCTCCTGAGCAGG - Intronic
961784088 3:129339046-129339068 GCGCCCCTCACCTCCCGGGCGGG + Intergenic
964474872 3:157089202-157089224 GCGCCCCTTGCCTGGCGCGGAGG - Intergenic
964766038 3:160178990-160179012 GCGCCCCTCACCTCCCGGGCGGG - Intergenic
965390200 3:168095416-168095438 GCGCCACTTCCCCTCCGGGCCGG - Exonic
966933029 3:184687881-184687903 GGGCCCCTCCCCGGGCGCGCGGG + Intergenic
968556440 4:1248494-1248516 CCGCCCCATCCCGGCCCCGCAGG + Intronic
968620780 4:1602667-1602689 GCGCCCCCTCCCCGCCAGGCAGG + Intergenic
968919017 4:3512937-3512959 TGGCCTCTTCCCTGCCGGGCTGG + Exonic
969577253 4:8043632-8043654 GCTCCCCATCCCTGGCCCGCAGG - Intronic
969702659 4:8776223-8776245 GGGCCCCTTCCCTGCTCCCCAGG - Intergenic
969713418 4:8857440-8857462 CCGCGGCTTCCCTGCTGCGCCGG + Intronic
969722136 4:8898010-8898032 GTGCCTCCTCCCTGCCACGCTGG + Intergenic
970195197 4:13544872-13544894 CCTCCCCTTCCCTGCTGGGCAGG + Exonic
971661131 4:29417568-29417590 GCACCCCTTCCTTGCCTCACTGG - Intergenic
977021717 4:91768645-91768667 CAGCCCCTTCTCTGCCGTGCTGG - Intergenic
977205186 4:94158254-94158276 GCGCCCCTCACCTCCCGGGCGGG - Intergenic
978741867 4:112145790-112145812 GGGCCCCTTCCCTCCAACGCCGG - Intronic
979349484 4:119628135-119628157 GAGCCCCTTCCCTGCAGCTCCGG - Intronic
979831911 4:125315097-125315119 CCGCCCCTTCCCCGCCGCACAGG - Intergenic
982107123 4:152020853-152020875 GCACCCCTTCCCTGCCACTAAGG - Intergenic
982132437 4:152242699-152242721 GGCCCCCTTCCCTGCCTCTCAGG + Intergenic
983217998 4:165019796-165019818 GCGCCCCTCACCTCCCGGGCGGG + Intergenic
983218176 4:165020267-165020289 GCGCCTCTGCCCCGCCGCCCCGG - Intergenic
987123777 5:14792366-14792388 GCACCTCTTCCCTGCCACTCTGG - Intronic
989634898 5:43522359-43522381 GCGCCCCTCACCTCCCGGGCGGG - Intergenic
990545211 5:56815522-56815544 CCGCCCCCTCCCTCCCTCGCAGG + Intergenic
991707229 5:69369611-69369633 GCGCCCCTAGCCTGCCCCGGCGG + Intronic
997371036 5:133360087-133360109 GCCTCCCTTCCCTGCAGGGCTGG + Intronic
997485194 5:134225576-134225598 GCGCCCCCTGCCTCCCGCGCAGG - Intronic
997874939 5:137538240-137538262 GCGCCCCTCACCTGCCGGACAGG + Intronic
998025190 5:138810877-138810899 GCGCCCCTCACCTCCCGCACGGG + Intronic
998053767 5:139056725-139056747 GCGCCCCTCACCTCCCGGGCGGG - Intronic
998251522 5:140556969-140556991 GAGCCCCTTCTCTGCTGCTCAGG - Intronic
1002524148 5:179806363-179806385 GCGCCCCTTCCCCGCCCGGGCGG - Intronic
1002632776 5:180591822-180591844 CCGCCCCTGCCCTGGCGCGAGGG - Intergenic
1003290685 6:4776294-4776316 CCGCCCCGCCCCTCCCGCGCGGG + Intronic
1005063563 6:21797506-21797528 GCGCCCCTCACCTGCCGGACGGG + Intergenic
1005965101 6:30721419-30721441 GCGCCCCGGCCCCGCCCCGCAGG - Intronic
1006281858 6:33059888-33059910 GCGCCCCTCACCTGCCGGACGGG + Intergenic
1006342084 6:33452526-33452548 CCGCCCCCTCCCTGCCCCGGTGG - Exonic
1007282745 6:40724300-40724322 CCTGCCCTTCCCTGCCCCGCTGG + Intergenic
1011672379 6:89695556-89695578 GGGCTCCTTCCCTGACGTGCTGG - Intronic
1016954764 6:149615671-149615693 GCGCCCCTACCCAGCCTCCCAGG - Intronic
1017851409 6:158308842-158308864 GCGCCCCTTACCTCCCGGACGGG + Intronic
1017875913 6:158524196-158524218 GGGCCCCTTCCCGGCAGCCCTGG + Intergenic
1017996928 6:159540374-159540396 GCGCCCTTTCCTTGCAGTGCTGG - Intergenic
1018901849 6:168055639-168055661 GCGCACCTCCCCTGCCGCACAGG + Intergenic
1019305600 7:332973-332995 GAGCCCCTTCCGTGGAGCGCGGG + Intergenic
1019515334 7:1437504-1437526 GGGCCCCTTGGCTGGCGCGCGGG + Intronic
1021668614 7:23013492-23013514 CCGTCCCCTCCCTGCCGCGGCGG - Intronic
1022103009 7:27180313-27180335 CCGCCCCCTCCCTGCCCCCCAGG + Intergenic
1022156075 7:27662930-27662952 GCGCTCCTTCCCTCGCGCGTGGG - Exonic
1023021431 7:36015153-36015175 GTGCCCCTTCCCTTCCTCACTGG - Intergenic
1023638745 7:42237794-42237816 TCGCTCCTTCCAGGCCGCGCCGG + Intronic
1026862036 7:73797176-73797198 GCGCCCCTCACCTGCCGGACGGG + Intergenic
1028019222 7:85749843-85749865 GCGCCCCCTCCCTGCCGTCTGGG - Intergenic
1028369867 7:90078995-90079017 CCTCCCCTTCCCTGCCTCCCAGG - Intergenic
1028899128 7:96076142-96076164 GCGCCCCATCCCGTCCACGCAGG - Exonic
1030036161 7:105410592-105410614 GCGCCCCTCACCTCCCGGGCGGG + Intergenic
1033406366 7:141074003-141074025 CCGCCCCCTCCCCGCCCCGCAGG - Intergenic
1033461632 7:141551638-141551660 GAGGCCCTCCCCTGCCGCGCCGG - Intronic
1034401397 7:150863984-150864006 GGGCCCCTTCCCTTCCTCCCAGG + Intergenic
1035464450 7:159065401-159065423 GGGTCCCTTCCCTGCCCCTCTGG + Intronic
1035905927 8:3510253-3510275 GCGTCCCTTGCCTGCAGCCCAGG + Intronic
1036910917 8:12755855-12755877 GGGACGCTCCCCTGCCGCGCGGG + Intronic
1037987474 8:23299024-23299046 GCTCCCCTTCCCTGAGGTGCTGG - Intronic
1045231305 8:100309813-100309835 CCGCCCCTTCTCTCCCGCTCCGG + Intronic
1045489204 8:102656132-102656154 CCGCCCCGTCCCCTCCGCGCCGG + Intergenic
1045524271 8:102928740-102928762 GCGCCCCTCACCTCCCGGGCGGG - Intronic
1049217588 8:141415218-141415240 GGGCCCGTTCCTTGCCGCGCTGG - Intronic
1049550075 8:143253183-143253205 CCGCCCCGTCCCTGCTGCGCTGG - Intronic
1049704941 8:144037225-144037247 GCGCCCCTCACCTCCCGGGCGGG - Intronic
1049755164 8:144308199-144308221 GCCCCCCTTCCCCGCCGTGTGGG + Intronic
1051430597 9:16977456-16977478 GCGCCCCTCACCTGCCGGACGGG + Intergenic
1052494660 9:29212240-29212262 GTCCCCCGCCCCTGCCGCGCGGG + Intergenic
1055133793 9:72806131-72806153 GCGCCCCTCACCTCCCGGGCGGG + Intronic
1057572989 9:96218339-96218361 GCGGCCATCCCCTGCCCCGCCGG + Intergenic
1057784246 9:98074602-98074624 GCGCCCCTTCCCTTTCCAGCAGG + Intronic
1060661689 9:125408456-125408478 TCGGGCCTTCCCAGCCGCGCGGG + Intergenic
1060687430 9:125624466-125624488 GCGCCCCTTACCTCCCGGACGGG - Intronic
1061811317 9:133164013-133164035 GAGCCCCTTCCCTGCGGCCTGGG + Intergenic
1062084627 9:134642275-134642297 GCGCCGCCTCCGAGCCGCGCAGG + Exonic
1062269497 9:135702082-135702104 GCGCCCCCTGCCGGCCGCGCCGG - Intergenic
1062361315 9:136189625-136189647 GGGCGCCTTTCCTGCCGCCCAGG - Intergenic
1062437727 9:136554078-136554100 GAGCCCCTTCCCTGCAGCGTAGG + Intergenic
1203787041 EBV:133879-133901 GCGCCCCCTCCCTGCCTCACGGG + Intergenic
1203562718 Un_KI270744v1:71800-71822 GCGCCCCTCACCTGCCGGACGGG - Intergenic
1192352779 X:70371562-70371584 GCGCCCCTTACCTCCCGGACGGG + Intronic
1196707283 X:118727513-118727535 GCGGCCCTTCCCGTCTGCGCCGG + Intergenic
1197767961 X:130071278-130071300 GAGCCCCTTCCCTGCTGCCAGGG - Intronic
1198750517 X:139932839-139932861 CCGCCCCGCCCCTCCCGCGCTGG - Intronic
1198871036 X:141177210-141177232 ACGCCCCTCCCCCGTCGCGCCGG - Intergenic
1199586551 X:149421177-149421199 GCGCCCCTCACCTCCCGGGCGGG - Intergenic
1200077083 X:153556550-153556572 GGGCCCCTGCCCTGCTGCTCTGG - Intronic
1200129006 X:153830923-153830945 GCGCCCCTCCCCCGCCGCCGTGG - Intergenic