ID: 937222552

View in Genome Browser
Species Human (GRCh38)
Location 2:120350146-120350168
Sequence GCCTCCAGGATACCAGCAAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937222546_937222552 5 Left 937222546 2:120350118-120350140 CCAGACGCATCCTGCCACCCACA 0: 1
1: 1
2: 0
3: 12
4: 191
Right 937222552 2:120350146-120350168 GCCTCCAGGATACCAGCAAATGG 0: 1
1: 0
2: 1
3: 10
4: 132
937222547_937222552 -5 Left 937222547 2:120350128-120350150 CCTGCCACCCACACAGCAGCCTC 0: 1
1: 1
2: 10
3: 81
4: 723
Right 937222552 2:120350146-120350168 GCCTCCAGGATACCAGCAAATGG 0: 1
1: 0
2: 1
3: 10
4: 132
937222548_937222552 -9 Left 937222548 2:120350132-120350154 CCACCCACACAGCAGCCTCCAGG 0: 1
1: 1
2: 3
3: 86
4: 664
Right 937222552 2:120350146-120350168 GCCTCCAGGATACCAGCAAATGG 0: 1
1: 0
2: 1
3: 10
4: 132
937222545_937222552 15 Left 937222545 2:120350108-120350130 CCACGCACAGCCAGACGCATCCT 0: 1
1: 0
2: 3
3: 13
4: 154
Right 937222552 2:120350146-120350168 GCCTCCAGGATACCAGCAAATGG 0: 1
1: 0
2: 1
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937222552 Original CRISPR GCCTCCAGGATACCAGCAAA TGG Exonic
902031057 1:13422551-13422573 GCCTCCCTGTTACCAGGAAATGG - Intergenic
903847127 1:26285243-26285265 GTCTCCAGGGTGCCAGCAGAGGG + Intronic
905894000 1:41533619-41533641 GCCTCCAGAAGGCCAGCAAGAGG - Intronic
906782241 1:48583039-48583061 GCCTCCATGATACTAGGAAGGGG + Intronic
907550478 1:55300807-55300829 GCCTCCTGGTGACCAGCAAGTGG - Intergenic
916872574 1:168933024-168933046 GTCTCCATGATGCCAGGAAAAGG - Intergenic
917065246 1:171085956-171085978 GACTCCAGAATACCATCAAGAGG - Intergenic
918914767 1:190620932-190620954 GATTCCTTGATACCAGCAAATGG + Intergenic
918957749 1:191232253-191232275 CCATCAAGGATACCAACAAAGGG + Intergenic
919293473 1:195663777-195663799 CCCTCCAGCATACCACCAACGGG - Intergenic
923855189 1:237838656-237838678 GCCTCCAGAACCCCAGCAGAAGG + Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
924416312 1:243860118-243860140 GGTTCCAGCACACCAGCAAATGG + Intergenic
1063430229 10:5981787-5981809 CCCTACAAGATACCAGCAGATGG + Intergenic
1066535163 10:36383152-36383174 GCCTCCAGGATATAAACAATTGG + Intergenic
1067913147 10:50367532-50367554 ACCTCCAGGAGACCAGCAGAAGG - Intronic
1069455751 10:68552459-68552481 GGCTCAAGGATACAAGCTAATGG + Intergenic
1074048121 10:109857802-109857824 GCCTCCAGGCTGCCAGGAAGGGG + Intergenic
1074316066 10:112362821-112362843 GCCTACAGAATATAAGCAAAAGG - Intergenic
1076747832 10:132523218-132523240 GCCTCCAGGACCACAGCAGAGGG - Intergenic
1077478001 11:2800035-2800057 GTCTCCAGGCTCCCAGCCAAGGG + Intronic
1077558755 11:3242395-3242417 GCCTCAAAGCTACCCGCAAAAGG - Intergenic
1077905336 11:6528647-6528669 ACCTCCAAGATACCAGCAATTGG - Exonic
1079429159 11:20371911-20371933 CCCTCCAGGACACAAACAAAAGG + Intronic
1083317856 11:61827656-61827678 GCCACCAGGGTGCCAGCAAGCGG - Intronic
1084483221 11:69433967-69433989 GACTCCAGGGGACCAGCAAGTGG + Intergenic
1087053768 11:93911504-93911526 CCCTCCTGGATAACAGAAAAAGG - Intergenic
1089237770 11:117047316-117047338 TCCTCCAGGATTCTAACAAAGGG - Intronic
1093090699 12:14917120-14917142 ACCTCCAGGACACTAGGAAAAGG - Intronic
1093116821 12:15221610-15221632 GCCTCCAGGCTCCCACCGAAGGG + Intronic
1093372056 12:18377150-18377172 GGCTCCAGGATGCCAGCAATGGG + Intronic
1093940842 12:25052306-25052328 GGCTCCAAGAAACCAGCCAACGG + Intronic
1094280200 12:28728640-28728662 TCCTCCAGGAAACAAGAAAAAGG - Intergenic
1095173547 12:39062793-39062815 GCTTCCCGAATTCCAGCAAAGGG - Intergenic
1096153529 12:49329492-49329514 GCCTCCAGGCTGGCAGCACAGGG - Intronic
1099815680 12:87644415-87644437 GCCTCCAGGATAACATGGAATGG + Intergenic
1100662617 12:96716662-96716684 GCCTCCAGGATAGCAGCACTTGG - Intronic
1106623774 13:31397617-31397639 TCCTCCAGGACACAAACAAATGG - Intergenic
1108416816 13:50206017-50206039 GCCTCAAGGAGACCAGGAAGAGG + Intronic
1108826440 13:54417583-54417605 TCTTTGAGGATACCAGCAAAAGG - Intergenic
1110293704 13:73837913-73837935 GACGCCAGGATTCCACCAAATGG + Intronic
1113767295 13:112889324-112889346 TCCTCCAGTGTCCCAGCAAAGGG + Intergenic
1116028233 14:39538770-39538792 GCCCCCAGGAGACAAGCAAAAGG + Intergenic
1117975836 14:61295878-61295900 GCCACAAGAAAACCAGCAAAGGG - Intronic
1120356356 14:83439195-83439217 ACATCCAGGATACCACAAAATGG - Intergenic
1120870285 14:89330523-89330545 ACCTCCAGGCTCCCTGCAAATGG - Intronic
1122200282 14:100118503-100118525 GCTTGCAGAATAGCAGCAAAGGG + Intronic
1122395462 14:101425644-101425666 AGCTCCAGCCTACCAGCAAAAGG + Intergenic
1131324343 15:91428115-91428137 GCCTCCAGGATAACTGGATATGG - Intergenic
1132594380 16:741485-741507 GTCTCCAAGATAACAGAAAAAGG - Intronic
1132674171 16:1114817-1114839 GCCTCCAGGATCCCAGGATGGGG + Intergenic
1132760694 16:1507288-1507310 GCCACCTGGACACCAGCAGAGGG - Exonic
1133767594 16:8848694-8848716 GCCTCCAGGAAGCCAGCCAGGGG - Exonic
1134339468 16:13332143-13332165 TTCTCCAGTATACCAGCAGAGGG - Intergenic
1141180770 16:81752205-81752227 GCCTCCAGGCTTCCAGCATCAGG - Intronic
1142223360 16:88865860-88865882 GCCTCCAGGAGTGCAGCAACAGG - Exonic
1142594615 17:1023391-1023413 GCCTCCAGGCTGCCTGCACAGGG - Intronic
1143434092 17:6909701-6909723 GCCTCCAGAATCCCAACAAGAGG - Intronic
1144251335 17:13419752-13419774 GCCTGCAAGATAGCAGCTAAGGG - Intergenic
1144327062 17:14192584-14192606 GCCTCCAGTCTCCCATCAAAGGG + Intronic
1144475949 17:15589447-15589469 GCCTCCAGTCTCCCATCAAAGGG + Intronic
1145775427 17:27524576-27524598 GCCTCCAGTATCTCTGCAAAGGG + Intronic
1146131387 17:30279318-30279340 GCCCCCAGGGGACAAGCAAAGGG - Intronic
1147678524 17:42224059-42224081 GTCTCCAGGATGCCTGCAAGAGG - Intronic
1153583229 18:6596532-6596554 GCATCCAGGATTCCACCAAGTGG + Intergenic
1155701369 18:28748065-28748087 GCCACCAGCAAACCAGAAAAAGG + Intergenic
1157141435 18:45111099-45111121 GCCTCCAGGCCAACTGCAAAAGG - Intergenic
1157682788 18:49619969-49619991 GCCTTCAGGCTACCAGCTCATGG - Intergenic
1157844987 18:50994889-50994911 GCCTCTGGGATACCAGTGAAAGG + Intronic
1160954243 19:1682834-1682856 GCCTGCAGGGAACCAGCAACGGG - Intergenic
1164473827 19:28557230-28557252 GCCTTCAGGATAGGAGGAAATGG - Intergenic
1164734750 19:30532618-30532640 ACCTTCATGATTCCAGCAAAAGG + Intronic
1167196100 19:48029849-48029871 GCTTCCAGGAAATCAGGAAAAGG + Intergenic
1167380249 19:49134211-49134233 GGCCCCAGGATTCCAGCAAGAGG - Intronic
925023943 2:593555-593577 CCCTCCAGTAAACCAGGAAAAGG + Intergenic
926419679 2:12684506-12684528 GCCTCCAGCAAAACTGCAAAAGG + Intergenic
928262930 2:29783878-29783900 TCCTCCAGGATTCCACCAAGTGG + Intronic
928541742 2:32291888-32291910 GCTTCCAGGAGACTGGCAAAAGG + Intronic
929514010 2:42589869-42589891 ACCTCCAGGATACCAAACAAAGG - Intronic
930521000 2:52467469-52467491 GGCTCCAACATACCAGCCAAAGG + Intergenic
932381004 2:71282684-71282706 ACCTCCAGGTTACCAGTAGAGGG - Intronic
932613557 2:73217538-73217560 GCTTCCAGGAAACCAGGCAAGGG + Intronic
933643158 2:84785962-84785984 GCCTACAGAATACCATCAATTGG + Intronic
937222552 2:120350146-120350168 GCCTCCAGGATACCAGCAAATGG + Exonic
940419592 2:153464107-153464129 GCTTCCAGGTGACCAGCTAATGG - Intergenic
942891630 2:180996638-180996660 CCCTCCAAGATACCTGGAAATGG - Intronic
945991501 2:216399437-216399459 GCCTCCACTATACCAGCCATTGG + Intergenic
947611516 2:231527697-231527719 GGCTCCAGGATGACAGAAAATGG - Intronic
1168765791 20:381101-381123 GCCTCCAGGGCACCAGCAGGTGG - Exonic
1169112796 20:3044494-3044516 TCCTCCAGGGTACCAGCCATGGG - Exonic
1178287690 21:31338934-31338956 GCCCCCATGATACTAGGAAAGGG - Intronic
1178929129 21:36802230-36802252 GCCTCCAAGATTGCAGCATAAGG + Intronic
1180087659 21:45515297-45515319 GCCTCTTGGATACCAGCTCAGGG - Exonic
1182073926 22:27482017-27482039 GCCTCCATGAAACCAGCACTTGG + Intergenic
1182876969 22:33700659-33700681 GCCTCCAGGCCACCAGCATTTGG - Intronic
1184343821 22:43900895-43900917 GGCTCCAGGTAACCAGCCAAGGG + Intergenic
951099730 3:18673297-18673319 GTTTCCAGGATACCAGCCTATGG - Intergenic
952616172 3:35276596-35276618 ATCTCCAGGCTACCAGCAGAAGG - Intergenic
953151589 3:40330088-40330110 GCCTCCAGGCTTCCATCCAAGGG + Intergenic
955547384 3:60045688-60045710 GCCTCCAGGATGGAAACAAATGG + Intronic
961588991 3:127961057-127961079 TCCTCCAGAAGACCAGCAAGTGG - Intronic
964246140 3:154656270-154656292 GCCTTGAGGATACCAGCTATTGG - Intergenic
964676504 3:159288423-159288445 GCCTCTAAGATCCTAGCAAAAGG - Intronic
965911458 3:173782624-173782646 GCCCCCAGGAGAGCAGGAAAGGG + Intronic
968764968 4:2463347-2463369 GCCACCTGGATGCCGGCAAAGGG - Intronic
969296451 4:6273019-6273041 GCCTCCAGGATGCCAGTCCAGGG - Intronic
969640705 4:8396764-8396786 GCCGCAAGGCTTCCAGCAAATGG - Intronic
969872719 4:10115006-10115028 CCCTCCAGGAGGCCAGCAACTGG - Intronic
972626162 4:40801174-40801196 ATCTCCAGGATGCCAACAAAGGG - Intronic
972836508 4:42877151-42877173 GCCTCCATGATTTCAGGAAAGGG + Intergenic
981236735 4:142425368-142425390 GACTCCAGTAGCCCAGCAAATGG + Intronic
987829123 5:23073581-23073603 GCTTCCCAGATACCAGCCAAGGG - Intergenic
990641653 5:57792104-57792126 TACTCCAGGATACCATCAGAAGG - Intergenic
993057293 5:82996747-82996769 ACCTCCAGGATATGAGGAAAAGG + Intergenic
997852704 5:137346937-137346959 TCCTGCAGGATACCAGCCAACGG + Intronic
998900437 5:146847547-146847569 GCCTCCAGGAACCCACCACAGGG + Intronic
1001319335 5:170667524-170667546 GTCTCCACCAGACCAGCAAATGG + Intronic
1009229342 6:61043552-61043574 GCCCCCAGGAGACCAGCAAAAGG - Intergenic
1011720125 6:90147476-90147498 GGATCCAGGATACCAGCGAGTGG - Intronic
1015494322 6:133865012-133865034 GCCCCCAGGAGACAACCAAATGG - Intergenic
1017861118 6:158398194-158398216 GCCCCCAGCATACCAGCCATAGG + Intronic
1029520577 7:101059023-101059045 GCCTCTTGGACACCAGCAAATGG - Intergenic
1033645999 7:143304876-143304898 GGCTTCAGGAGAGCAGCAAACGG - Intronic
1035287762 7:157817013-157817035 GCCTCCGGGGTGTCAGCAAATGG - Intronic
1035392464 7:158514356-158514378 GACCCCAGGATGGCAGCAAAGGG + Intronic
1039313064 8:36341102-36341124 GCCTCTATGATACCCGTAAAGGG - Intergenic
1048299858 8:133243565-133243587 GCTTCGAGGACACCAGCACAGGG - Intronic
1049520760 8:143088979-143089001 GCCTCCAGGACACATGCAAATGG + Intergenic
1051099295 9:13502738-13502760 TGCTCCAGGAAACCAGCAAGTGG - Intergenic
1052458759 9:28735490-28735512 GCCTGCATGATACCACCAAATGG - Intergenic
1052489668 9:29149648-29149670 GCCTCCAGGATCCTAGCTACAGG + Intergenic
1053284134 9:36839538-36839560 CCCTCCAGGACCCCAGCAAGTGG - Exonic
1055814808 9:80192327-80192349 GGCTCCTAGATCCCAGCAAAGGG - Intergenic
1058115422 9:101079254-101079276 ATCTCCAGGATGACAGCAAAGGG - Intronic
1059475845 9:114547038-114547060 GACTCCAGGATATGAGCAACAGG - Intergenic
1060134329 9:121137067-121137089 GCCTCCAGGATGCCAGGAGCAGG + Intronic
1060186886 9:121568945-121568967 GCTTCCAGGAGATCAGCAACCGG - Intronic
1060902702 9:127274642-127274664 ACTCCCAGGATACCAGCATAAGG - Intronic
1062030681 9:134360589-134360611 GCCTCCCGCAGACCAGCAAGCGG - Intronic
1062208872 9:135352432-135352454 GCCTCCAGGAAACAAAGAAATGG + Intergenic
1192459437 X:71304372-71304394 GCCTACAGGTTAACAGCAAATGG - Intronic
1193274647 X:79571010-79571032 GCCTCCAGGATCCCCGGCAAAGG - Intergenic
1196583001 X:117397019-117397041 GCCCACAGGAGACAAGCAAATGG + Intergenic
1199773329 X:150989243-150989265 GCATCCAGGAGACCAGCAGCAGG - Exonic