ID: 937223044

View in Genome Browser
Species Human (GRCh38)
Location 2:120353120-120353142
Sequence TGGGGTCCCCAGGCCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937223044_937223052 -5 Left 937223044 2:120353120-120353142 CCAGGAAGGGCCTGGGGACCCCA No data
Right 937223052 2:120353138-120353160 CCCCAGGGGCACAAGGCCTTGGG No data
937223044_937223054 -4 Left 937223044 2:120353120-120353142 CCAGGAAGGGCCTGGGGACCCCA No data
Right 937223054 2:120353139-120353161 CCCAGGGGCACAAGGCCTTGGGG No data
937223044_937223056 0 Left 937223044 2:120353120-120353142 CCAGGAAGGGCCTGGGGACCCCA No data
Right 937223056 2:120353143-120353165 GGGGCACAAGGCCTTGGGGCTGG No data
937223044_937223057 9 Left 937223044 2:120353120-120353142 CCAGGAAGGGCCTGGGGACCCCA No data
Right 937223057 2:120353152-120353174 GGCCTTGGGGCTGGCTGACCTGG No data
937223044_937223050 -6 Left 937223044 2:120353120-120353142 CCAGGAAGGGCCTGGGGACCCCA No data
Right 937223050 2:120353137-120353159 ACCCCAGGGGCACAAGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937223044 Original CRISPR TGGGGTCCCCAGGCCCTTCC TGG (reversed) Intergenic