ID: 937223044

View in Genome Browser
Species Human (GRCh38)
Location 2:120353120-120353142
Sequence TGGGGTCCCCAGGCCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 400}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937223044_937223056 0 Left 937223044 2:120353120-120353142 CCAGGAAGGGCCTGGGGACCCCA 0: 1
1: 0
2: 6
3: 47
4: 400
Right 937223056 2:120353143-120353165 GGGGCACAAGGCCTTGGGGCTGG 0: 1
1: 0
2: 2
3: 26
4: 358
937223044_937223057 9 Left 937223044 2:120353120-120353142 CCAGGAAGGGCCTGGGGACCCCA 0: 1
1: 0
2: 6
3: 47
4: 400
Right 937223057 2:120353152-120353174 GGCCTTGGGGCTGGCTGACCTGG 0: 1
1: 0
2: 1
3: 31
4: 348
937223044_937223054 -4 Left 937223044 2:120353120-120353142 CCAGGAAGGGCCTGGGGACCCCA 0: 1
1: 0
2: 6
3: 47
4: 400
Right 937223054 2:120353139-120353161 CCCAGGGGCACAAGGCCTTGGGG 0: 1
1: 0
2: 2
3: 31
4: 395
937223044_937223052 -5 Left 937223044 2:120353120-120353142 CCAGGAAGGGCCTGGGGACCCCA 0: 1
1: 0
2: 6
3: 47
4: 400
Right 937223052 2:120353138-120353160 CCCCAGGGGCACAAGGCCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 201
937223044_937223050 -6 Left 937223044 2:120353120-120353142 CCAGGAAGGGCCTGGGGACCCCA 0: 1
1: 0
2: 6
3: 47
4: 400
Right 937223050 2:120353137-120353159 ACCCCAGGGGCACAAGGCCTTGG 0: 1
1: 0
2: 5
3: 14
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937223044 Original CRISPR TGGGGTCCCCAGGCCCTTCC TGG (reversed) Intergenic
900166322 1:1245554-1245576 TGGGGTGCCCCCTCCCTTCCAGG + Intronic
900182820 1:1319896-1319918 TGGGGTCCCCAGTGCCTTCCTGG - Intronic
900252106 1:1676288-1676310 TGGGCTCCCCCGGCCCTCCCGGG + Intronic
900262516 1:1739146-1739168 TGGGCTCCCCCGGCCCTCCCGGG + Intronic
900389052 1:2426249-2426271 TGGGGTCCTCAGAATCTTCCAGG - Intronic
900506067 1:3030281-3030303 TGGTGACTCCAGGCCCCTCCTGG - Intergenic
900568472 1:3346939-3346961 AGGTGTCCCCAGGGCCTGCCTGG - Intronic
900591827 1:3463554-3463576 TGGCTTCCCCAGGCCCTTCATGG - Exonic
900620513 1:3584876-3584898 TAGAGTCCCCAGGCACCTCCGGG - Intronic
901059581 1:6465867-6465889 TGGGGCCCCCAGACCCTCCTGGG + Intronic
902368991 1:15993799-15993821 CGGGGTCCCCATGGGCTTCCTGG - Intergenic
902644401 1:17788463-17788485 TGGCTACCCCAGGCCCTGCCTGG - Intronic
903756098 1:25662037-25662059 TGGAGTCATCAGGCCCTTGCAGG + Intronic
904043748 1:27598552-27598574 AGGGGTCCCCAGGGACTGCCTGG - Intronic
904197747 1:28798498-28798520 AGGGGACCCAAGGACCTTCCTGG - Intergenic
904278176 1:29397697-29397719 TGGGGTCTCGAGGCTCCTCCAGG + Intergenic
905025463 1:34846501-34846523 CTGAGTCCCCAGGCCTTTCCTGG - Intronic
906155819 1:43613360-43613382 TGGGGGCACTAGGCCCTGCCTGG - Intronic
906300776 1:44680087-44680109 TCAACTCCCCAGGCCCTTCCAGG - Intronic
906711015 1:47930059-47930081 TTGGCTCCCCAGGCCCAGCCAGG + Intronic
908384728 1:63630264-63630286 TGGGCTCCCTGGGCCCTGCCAGG + Intronic
908419247 1:63943502-63943524 TGTGGTCTCCAAGTCCTTCCTGG + Intronic
909282202 1:73770361-73770383 TGGGGTCTCCAGGTCCTCGCTGG - Intergenic
909950279 1:81711804-81711826 TGGGGTCCCTGGACCCTTTCAGG - Intronic
915399469 1:155611819-155611841 TGGGGTCCCCATACCCATCGTGG - Exonic
915416582 1:155747399-155747421 TGGGGTCCCCATACCCATCGTGG - Intergenic
915509704 1:156379870-156379892 TGAGGTTCCCAGGTCCATCCTGG - Intronic
916425504 1:164676172-164676194 TGGAGTCCCCAGGTCATCCCAGG - Intronic
916512506 1:165484825-165484847 TGGTGTCCTCTGTCCCTTCCAGG - Intergenic
917477164 1:175378775-175378797 TGTGGACACCAGGCCCTGCCTGG - Intronic
918451450 1:184663538-184663560 GGGAGTCCCCAGTCCCTCCCCGG - Intergenic
919791056 1:201291285-201291307 TGTGGCCTGCAGGCCCTTCCAGG - Intronic
920400001 1:205670532-205670554 GGGGGACCCCAGCCCCATCCCGG + Intronic
920460873 1:206139209-206139231 GAGGGTCCCCAAGCCCTCCCAGG + Intergenic
922764815 1:228151241-228151263 TGGGATCCCCAGGCCTTGCCAGG - Intronic
922962681 1:229662101-229662123 TCAGCACCCCAGGCCCTTCCAGG - Intergenic
923084620 1:230694174-230694196 AGGAGTCGGCAGGCCCTTCCTGG + Intergenic
924707035 1:246509964-246509986 GGGGGTCCCCATGGGCTTCCGGG + Intergenic
1063073673 10:2692417-2692439 TGGGTTCCCCAGGCGCTCACAGG + Intergenic
1064257730 10:13758551-13758573 TGTGGGCCCCAGTCCCTTGCAGG - Intronic
1066405990 10:35118962-35118984 TGGGGTCCCCAGGCACAGGCTGG + Intergenic
1067227787 10:44386657-44386679 GGGCGTCCCCAGGCCTTTGCTGG + Intergenic
1067260043 10:44681429-44681451 TGGGGTCCACAGGCCATGACTGG - Intergenic
1069828342 10:71267968-71267990 TGAGGTCCCCAGGATGTTCCTGG + Intronic
1070792929 10:79200386-79200408 GGGAGTCCCCAGGCCGCTCCAGG - Intronic
1071061022 10:81570911-81570933 TGGGGGCTCCAGGTCCTTGCTGG + Intergenic
1071480620 10:86062244-86062266 TGAGATGCTCAGGCCCTTCCAGG - Intronic
1071602094 10:86963293-86963315 AGGGGTCCCCAGGTCCTCCCAGG + Intronic
1071928091 10:90434577-90434599 TGGGATCACCAGGCCCTCTCAGG + Intergenic
1073142288 10:101256114-101256136 TGAGCTCCCCAGGCCCAGCCAGG + Intergenic
1074406039 10:113181050-113181072 GGGCATCCCCAGGCCCTCCCAGG - Intergenic
1074819187 10:117166239-117166261 TTGGGTCCCCAGCCCCCTCCCGG - Intergenic
1075395407 10:122123448-122123470 TGGGTTCCCCAGGTCCCTCGGGG - Intronic
1075779343 10:125006772-125006794 TGGGGTCCCCAGGCCCAGTGGGG + Intronic
1076474067 10:130740268-130740290 TGGGCTCCACAGGGCCTTCCGGG - Intergenic
1076668270 10:132104996-132105018 TGGGGCCCAGAGGCTCTTCCTGG + Intronic
1076785348 10:132746964-132746986 TGGGGTGGCCGGCCCCTTCCTGG + Intronic
1076848680 10:133082428-133082450 TGGGGGCCCCAGGCCACACCGGG + Intronic
1076855522 10:133113874-133113896 TGGGAGGCCCAGGCCCTTCCTGG - Intronic
1076910861 10:133388663-133388685 GGGGGTCCGAAGGCCCTGCCAGG - Intronic
1077005857 11:355846-355868 ACGGGTCCCCGGGCCCCTCCAGG - Intergenic
1077056051 11:593737-593759 TGCGCTCCGCCGGCCCTTCCAGG + Intronic
1077178901 11:1203570-1203592 TGGGGTGCCCAGGACCCCCCAGG + Intergenic
1077185099 11:1232242-1232264 TGGGGTCCCCAATCCCACCCAGG - Intronic
1077198581 11:1293767-1293789 TGCGGTCACCAGGCCCTGCCAGG + Intronic
1077418523 11:2437126-2437148 GGGGATCCCCAGGTCCTTCATGG + Intergenic
1077464718 11:2728242-2728264 TGGCTTCCCAAGGCTCTTCCTGG + Intronic
1077518727 11:3018385-3018407 GTGAGTCCCCAGCCCCTTCCTGG - Intronic
1077538731 11:3136523-3136545 TGCGGTCCCCAGGCCTCTGCAGG - Intronic
1078101970 11:8335227-8335249 CGGGGTCCCCAGGCCCTTTATGG + Intergenic
1078858197 11:15223722-15223744 TGGAGTCCCCAGCCCCTTCCAGG - Intronic
1079103140 11:17553664-17553686 TGGAGTCCCCAGCTCCTTCCAGG - Intronic
1079318802 11:19432661-19432683 TGGGGGCCCCAGCTCCTTCCTGG - Intronic
1080521012 11:33067819-33067841 TGGGTCCCCCAGGCTCTCCCAGG - Intronic
1080640010 11:34153122-34153144 TGGTGTCCCCAGGCCTCCCCTGG - Intronic
1081490574 11:43565219-43565241 AGTGGTCCTCAGGCCCTTCGAGG + Intronic
1082009245 11:47439114-47439136 TGGGGTCTCCAGGCAGTTCTGGG - Intronic
1082162371 11:48900132-48900154 TGGCTCCCCCAGCCCCTTCCTGG + Intergenic
1082167959 11:48968583-48968605 TGGCTCCCCCAGCCCCTTCCTGG + Intergenic
1082174776 11:49048127-49048149 TGGCTCCCCCAGCCCCTTCCTGG + Intergenic
1082235583 11:49818036-49818058 TGGCTCCCCCAGCCCCTTCCTGG - Intergenic
1082239049 11:49852620-49852642 TGGCTCCCCCAGCCCCTTCCTGG - Intergenic
1082243097 11:49891726-49891748 TGGCTCCCCCAGCCCCTTCCTGG + Intergenic
1082283634 11:50298132-50298154 GGGGGTCCCCGGGCCCTGGCTGG + Intergenic
1083235427 11:61347918-61347940 TTGGGCCCCCAGCCCCTCCCAGG + Exonic
1083317612 11:61826317-61826339 TGGGGACCCCAGGCCCTGGCCGG + Intronic
1084374413 11:68766258-68766280 AGGGGTCCCCAGGCTCTCCTAGG + Intronic
1084550748 11:69840406-69840428 TGGGTTGCCCAGACCCCTCCAGG + Intergenic
1084684891 11:70687760-70687782 TGGGGGCCCCTGCCCCATCCAGG + Intronic
1084903785 11:72330316-72330338 GGTGGTGCCCATGCCCTTCCAGG - Intronic
1085315188 11:75540484-75540506 TGGGCTGGCCAGGCCCATCCAGG + Intergenic
1086691000 11:89787961-89787983 TGGCTCCCCCAGCCCCTTCCTGG - Intergenic
1086714802 11:90051694-90051716 TGGCTCCCCCAGCCCCTTCCTGG + Intergenic
1089365733 11:117919934-117919956 TGGGGCCCCCTGGCCCTGCAGGG + Intronic
1089602715 11:119625166-119625188 TCATGTCCCCAGGCCCTTCCTGG - Intronic
1089617560 11:119703518-119703540 TGGAGTCTCCTGGCCCATCCTGG - Intronic
1089784840 11:120900596-120900618 TCAGCACCCCAGGCCCTTCCCGG - Intronic
1090398684 11:126435073-126435095 TGGGGTCCCTAGGCCCAAGCTGG + Intronic
1091961934 12:4703046-4703068 TGAGGTCCCCAGTTCCTTGCTGG - Intronic
1094682652 12:32679599-32679621 TGGGGGCCCCAGGGCTCTCCGGG + Intronic
1096122686 12:49098353-49098375 TGGTGTCCCCAGGAACTCCCAGG + Intronic
1096168487 12:49446500-49446522 TGAGGTTCCCAGTTCCTTCCTGG + Intronic
1096651755 12:53065328-53065350 AGAGGTCCCCTGGCCCTGCCAGG + Exonic
1097527724 12:60759308-60759330 TGAGGTCCCCATGTCCTTTCAGG + Intergenic
1101404172 12:104413367-104413389 TGGGCTGCCCAGGCCCCTCCAGG + Intergenic
1104047170 12:125171644-125171666 TGGGGTCCCCATTTCCTTGCTGG + Intergenic
1104124994 12:125837904-125837926 AGGGGTCCACTGGCCCATCCAGG + Intergenic
1104643161 12:130480122-130480144 TGGGGTCCCCAAGCCACTCCTGG + Intronic
1104927829 12:132322718-132322740 TGGGCTCACCAGGCCCTCCCAGG - Intronic
1105292183 13:19060292-19060314 TGGGACCCCCAGCCCCTGCCTGG - Intergenic
1105599694 13:21875755-21875777 TGGTGTCCCCTGACCCTTGCTGG + Intergenic
1112008324 13:95273350-95273372 TTGGGACCCCACGCCCATCCAGG - Intronic
1112051832 13:95650354-95650376 TGGGGACACCTGGCCATTCCTGG - Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1112656999 13:101462039-101462061 TGTGGTCCCCAGTTCCTTGCTGG + Intronic
1114459458 14:22877382-22877404 TGGGGCCCCCAGGACCAACCCGG + Exonic
1115518899 14:34213207-34213229 AGGAGTCTCCAGGCCCTTCGAGG + Intronic
1118999825 14:70871936-70871958 TGGGGGCCCAAGGCCCTTCATGG - Intergenic
1119173478 14:72552326-72552348 TGGGGCCCCTAAGCACTTCCCGG + Intronic
1119264873 14:73258855-73258877 TCGGGTTCCCAGGCCCTGCCTGG + Intronic
1119935512 14:78589106-78589128 TGGAGACCCCAGTCCTTTCCAGG - Intronic
1121928202 14:97948360-97948382 TGGGCCCTCCAGCCCCTTCCAGG - Intronic
1122046878 14:99030124-99030146 TGGGGTCCACCGGCTCCTCCAGG + Intergenic
1122113193 14:99515572-99515594 TGGGGTCCACAGGCCCCACTAGG + Intronic
1122771173 14:104098616-104098638 TGGGGTCCCCAGGCCCCTGCAGG + Intronic
1122788685 14:104175445-104175467 CGGGGTGCCCACGGCCTTCCTGG - Exonic
1122847296 14:104506863-104506885 TGGGCAGCCCAGGCCCTGCCTGG + Intronic
1123060301 14:105591421-105591443 TGGGATGACCCGGCCCTTCCTGG - Intergenic
1123480466 15:20626872-20626894 TGGGGTCAAAAGCCCCTTCCTGG + Intergenic
1123637542 15:22373495-22373517 TGGGGTCAAAAGCCCCTTCCTGG - Intergenic
1124366994 15:29079197-29079219 TGGGTTCCACATGCCCTTCTTGG + Intronic
1124377260 15:29136085-29136107 TGGGTTCCCCAGGCCCGGGCTGG + Intronic
1124563366 15:30794743-30794765 TGGGGTGCCCAGGCCTCACCTGG + Intergenic
1125181569 15:36885587-36885609 TTGGAAACCCAGGCCCTTCCTGG + Intergenic
1125609098 15:40958838-40958860 TGGGGTCCTCAGGGCCTGGCCGG - Intergenic
1126080472 15:44956588-44956610 TGAGGGCCTCAGGCCCTTCCCGG + Intergenic
1127973947 15:63983505-63983527 TGGGGTCCCCAGGACCCACAGGG - Intronic
1128539821 15:68518698-68518720 TAGGGTCCCCAGGGGCTTCCTGG + Intergenic
1128995273 15:72290268-72290290 TGGGGTCCCCAGGTCATTCCTGG - Intronic
1129329801 15:74821189-74821211 TGGGGCCCCCAGGCCAAGCCAGG + Exonic
1129387287 15:75202850-75202872 GGGTGTCCCCAAGCCCCTCCCGG - Intronic
1129600329 15:76994915-76994937 TGGGGTTCCTGGGCCCCTCCTGG + Intronic
1129723512 15:77890349-77890371 TGGGCTACCCAGGCCCATCAGGG - Intergenic
1132338891 15:101065768-101065790 CGGGGTCCCCAGCCCCCTCAGGG + Exonic
1132503612 16:296192-296214 TGGGGACCCCAAGGCCTTGCGGG + Intronic
1132556836 16:576283-576305 AGGGGTCCCCACGCCCACCCGGG - Intronic
1132563777 16:611191-611213 CGTGGTCCCCAGGCTTTTCCCGG + Intronic
1132872022 16:2119567-2119589 TGAGGCCCCCAGGCCTCTCCTGG - Intronic
1133019704 16:2961952-2961974 TGGGGTCCCTAGGGCCTGACAGG - Intergenic
1133051936 16:3121926-3121948 TGGGGTCTCAAGGGCCTTCTTGG - Intergenic
1133229842 16:4361295-4361317 TGGGCTCCCCAGCCCCTATCCGG + Intronic
1133303162 16:4795401-4795423 TGTGCTCCCCAGGACCTGCCTGG + Intronic
1133744420 16:8675671-8675693 TGGGGCCTAGAGGCCCTTCCAGG + Intronic
1134184883 16:12076931-12076953 TGGTGTTGCCAGACCCTTCCAGG + Intronic
1134193095 16:12137535-12137557 AGGGCTCCCAAGGCCATTCCAGG - Intronic
1134520503 16:14917329-14917351 TGAGGCCCCCAGGCCTCTCCCGG + Intronic
1134551071 16:15138645-15138667 TGAGGCCCCCAGGCCTCTCCCGG - Intronic
1134708175 16:16315980-16316002 TGAGGCCCCCAGGCCTCTCCCGG + Intergenic
1134715391 16:16356013-16356035 TGAGGCCCCCAGGCCTCTCCTGG + Intergenic
1134951427 16:18352665-18352687 TGAGGCCCCCAGGCCTCTCCCGG - Intergenic
1134959366 16:18396146-18396168 TGAGGCCCCCAGGCCTCTCCTGG - Intergenic
1135055120 16:19225706-19225728 TGGGGACCTCAGTTCCTTCCTGG + Intronic
1135776118 16:25258349-25258371 GCGTGGCCCCAGGCCCTTCCCGG + Intergenic
1138512400 16:57516219-57516241 TGGGGGCCGCAGGGCCATCCTGG - Intronic
1138539740 16:57680564-57680586 TGGGGTCTCCATGATCTTCCTGG + Exonic
1139436902 16:66941664-66941686 TGGGCTCCCCAGGCACTTGTGGG - Intronic
1139470008 16:67173397-67173419 TGTAGTCTCCTGGCCCTTCCTGG - Intronic
1139955361 16:70690566-70690588 TGAGGTCCCCAGGGCCTTGATGG + Intronic
1140439342 16:74975009-74975031 GGGGTTCCCCAGGCCATGCCAGG - Intronic
1141630225 16:85283595-85283617 TGGGGTCCACAGCCCATCCCAGG - Intergenic
1141735650 16:85850688-85850710 TCTGGTCCCCAGGCCTTCCCTGG - Intergenic
1141757805 16:86004150-86004172 TGGGGTCTCCATTCCCTTGCTGG - Intergenic
1142225162 16:88873615-88873637 AGGGGGCCCCAGAGCCTTCCTGG + Intergenic
1142413196 16:89926380-89926402 TGGGGCCTCCAAGCCCCTCCAGG - Intronic
1142682666 17:1559542-1559564 TTCGGTCCCCAGACCCTTGCTGG + Intronic
1143285359 17:5785130-5785152 TGGGGTCCTGATGCCCCTCCAGG + Intronic
1143371882 17:6445313-6445335 TGGGGTTTCCAGGCGTTTCCAGG - Exonic
1144458053 17:15434983-15435005 TGTGTACCCCAGGGCCTTCCAGG + Intergenic
1145935240 17:28711336-28711358 TGGGGTCCTGAGGCCCTGCTGGG - Intronic
1145974381 17:28975935-28975957 TGAGGGCTCCAGGCCTTTCCGGG - Intronic
1146266622 17:31457445-31457467 AGGGGTCCCCAGGCCTAACCTGG + Intronic
1146398648 17:32487277-32487299 TGCGGTCCCCAGGCGCAGCCGGG - Intronic
1146402468 17:32510711-32510733 AGGGGTCGCCAGGCCTCTCCCGG - Intronic
1148142818 17:45340411-45340433 TGGAGTCCTCAGGACCTTTCTGG + Intergenic
1148475356 17:47925131-47925153 TGTGTTCCCCAAGCCCCTCCTGG + Intronic
1150143927 17:62752374-62752396 CTGGGTCCCCAGGTGCTTCCTGG + Intronic
1150220337 17:63492458-63492480 TGGGCTGTGCAGGCCCTTCCAGG + Intronic
1150433688 17:65138509-65138531 CGGGGTCCCCAGGACTGTCCAGG - Intronic
1150694288 17:67390802-67390824 TGGGGTCACCAACCACTTCCTGG + Intronic
1151149933 17:72076339-72076361 TGAGGTAACCAGCCCCTTCCAGG - Intergenic
1151549601 17:74814404-74814426 CGGGCACCCCAGGCTCTTCCCGG + Intronic
1151699969 17:75737753-75737775 CAGGGTCCCCAACCCCTTCCTGG + Intronic
1151785103 17:76271608-76271630 TGGCCCCCCCAGGCCCTCCCAGG + Intergenic
1152195952 17:78918453-78918475 TGGTGTCCCCAGGACCTCCCAGG - Intronic
1152278088 17:79369644-79369666 TGGGCTCCCAAGGCCATTGCGGG - Intronic
1152313554 17:79566301-79566323 TGGAGACCCCAGGCCCAGCCTGG - Intergenic
1152350968 17:79784009-79784031 CGGGGCCCCCAGATCCTTCCGGG - Exonic
1152386154 17:79975973-79975995 TGGCGTCCCCATGCCCTGACTGG - Intronic
1152632263 17:81415565-81415587 TGCTGGCCCCAGCCCCTTCCTGG + Intronic
1152649312 17:81484571-81484593 AGGGGTCCCAAGGCCCACCCAGG - Intergenic
1152707052 17:81849596-81849618 AGGGGTCCCCAGGGCCTTACAGG - Intronic
1152732380 17:81978628-81978650 TGGGGTCCCCAGGCCTGGGCAGG + Intronic
1154148192 18:11884108-11884130 TGGGGCCACCAGGCCCTTCCTGG + Exonic
1154367618 18:13726109-13726131 AGAGGTCCCCCCGCCCTTCCGGG - Intronic
1155676080 18:28430425-28430447 TGAGGTCCCCAGGTCCTTAGTGG + Intergenic
1157158926 18:45295132-45295154 TTGAGTCCCCAGGCCACTCCTGG + Intronic
1158495827 18:57954488-57954510 TGGGAAGCCCAAGCCCTTCCAGG + Intergenic
1159018060 18:63118523-63118545 TGGGTTCCTCAGTCACTTCCTGG + Intergenic
1160420512 18:78740655-78740677 TGGGGTCCCTTGGAGCTTCCGGG - Intergenic
1160537511 18:79602994-79603016 CGGAGTTCCCAGGCCCTCCCTGG - Intergenic
1160741184 19:686834-686856 TCAGTTCCCAAGGCCCTTCCTGG + Intronic
1160786387 19:901858-901880 TTGGGTCCCCAGCCCCACCCAGG + Intronic
1161114894 19:2491188-2491210 CTGGGCCTCCAGGCCCTTCCCGG + Intergenic
1161175647 19:2841085-2841107 TGGAGTTCCCACGCCCGTCCCGG + Intergenic
1161461985 19:4402959-4402981 TGGGGACGCCAGGCCCTCGCTGG - Intronic
1161525990 19:4755782-4755804 AGAGGTGCCCAGTCCCTTCCGGG + Intergenic
1162101687 19:8342909-8342931 TGGGGTCCCCAGGCCGTCCCGGG + Intronic
1162479703 19:10921185-10921207 TGGTCACCACAGGCCCTTCCCGG - Intronic
1162536353 19:11264793-11264815 AGGTGTTCCCAGGCTCTTCCTGG - Intergenic
1162940491 19:14006183-14006205 TGGGGTCCCCGGGCCGGGCCTGG + Exonic
1163432667 19:17277566-17277588 TGGACTCCCCAGGCCCTGCTGGG + Intronic
1163518604 19:17779287-17779309 TGGGCCCATCAGGCCCTTCCTGG - Intronic
1163519068 19:17781261-17781283 TGGGGCTGCCAGGCCCTCCCTGG - Exonic
1163536672 19:17880906-17880928 TGGAGTCCCCGGGCTTTTCCTGG + Exonic
1163702961 19:18795696-18795718 TGGGGCCCCGGGGCCCTTCCTGG + Intergenic
1164400245 19:27897199-27897221 TGGGGTCTCCAGTTCCTTCTTGG + Intergenic
1164526805 19:29018965-29018987 AGGAATCCCCAGGCACTTCCAGG - Intergenic
1165423567 19:35733645-35733667 CGGGCTCCCCAGGCCGATCCAGG - Exonic
1165830839 19:38729469-38729491 GGGGCTGCCCAGGCCCCTCCTGG - Exonic
1166007659 19:39918204-39918226 CCTGGACCCCAGGCCCTTCCTGG - Exonic
1166101828 19:40575975-40575997 TGAGGTCCCCTGGACCATCCAGG + Exonic
1166295688 19:41888190-41888212 AGGCCTCCCCAGGCCCCTCCCGG + Exonic
1167330626 19:48853740-48853762 TGGCGACCCCAGGCCCTCCCGGG + Exonic
1167633377 19:50639456-50639478 TGGGGTCCCAAGACGCTTCAGGG + Intronic
925120095 2:1411672-1411694 TGGGGTCTCCAGGCACAACCAGG - Intronic
925576186 2:5362808-5362830 TGGGGTCTCCTGTCCCTTCCAGG - Intergenic
926400771 2:12493730-12493752 TGAGGTCACAAGGCCTTTCCTGG + Intergenic
927085365 2:19669897-19669919 AGGGGTCCTCAGAGCCTTCCTGG + Intergenic
928112173 2:28519530-28519552 TAGGGTTCCCAGGCACTGCCTGG + Intronic
929029242 2:37635533-37635555 TGGGGCTCCCAGGCCTTTCTGGG + Intergenic
929588491 2:43130675-43130697 TTGGGTTCCCAGGCTCTCCCAGG - Intergenic
930658446 2:54030157-54030179 TGGGGGCCCCAGGACCTTCAAGG + Intronic
932222740 2:70012114-70012136 TGGGTCCCCAAGACCCTTCCCGG + Intergenic
932436046 2:71703087-71703109 TGTGGCCCCCAGCCCTTTCCAGG - Intergenic
932827864 2:74958426-74958448 TGGGCTCCACAGGCCCGTCGGGG + Intergenic
934771872 2:96912487-96912509 TGGGCTTCCCAGGGCCCTCCTGG - Intronic
935361447 2:102250062-102250084 TGGCGTCTCCAGGCTCCTCCAGG + Intergenic
937157231 2:119729909-119729931 TTGGGTCCCTTTGCCCTTCCAGG + Intergenic
937223044 2:120353120-120353142 TGGGGTCCCCAGGCCCTTCCTGG - Intergenic
938070308 2:128304949-128304971 CATGGTCCCCAGGGCCTTCCTGG + Intronic
938084457 2:128389661-128389683 GGGGGTCCCCAGGCCCAGCTCGG + Intergenic
938192325 2:129295086-129295108 TGTAGTCCCCAGGCCTTTCGAGG + Intergenic
938825776 2:135004195-135004217 TGGTGTCCCAAGCACCTTCCAGG - Intronic
939500473 2:142976983-142977005 TGGTGTCCACAGCCCCTTACTGG - Intronic
942189491 2:173456285-173456307 TGGGGTCCCCATGGGCTTCCAGG - Intergenic
942231029 2:173860984-173861006 TCAGGGCCCCAGCCCCTTCCAGG - Intergenic
944934707 2:204555627-204555649 TGGAGTCCTCAAGACCTTCCAGG - Intronic
946690988 2:222308077-222308099 TTGGCTGCCCAGGCCCTGCCAGG - Intergenic
947202020 2:227622298-227622320 TGGGGCCCTCAGGCCATTCTGGG + Intronic
947964377 2:234267199-234267221 TGGGGCTTCCAGGCCCTCCCTGG - Intergenic
948420864 2:237859437-237859459 GGGCGTCTCCAGGCCCCTCCCGG - Intronic
948830692 2:240597046-240597068 TGGGCTCCCCCTGCCCTTCGAGG + Intronic
948847115 2:240688355-240688377 AGACGTCCCCAGGCCCTTCCAGG - Intergenic
1168804299 20:663531-663553 TGGGGACCCCCGGCCCGGCCCGG - Exonic
1170866589 20:20163320-20163342 TGTGGTCCACTGGACCTTCCTGG + Intronic
1171207138 20:23289860-23289882 TGGGGTCTCCTGGCCCTGGCAGG + Intergenic
1172092657 20:32445109-32445131 TGGGCCTCCCAGGCCCCTCCAGG - Exonic
1173163747 20:40671648-40671670 TGTGCTCACCATGCCCTTCCTGG - Intergenic
1174369783 20:50078758-50078780 TCCGGTCCCCAGCCCCTGCCAGG - Intergenic
1174952151 20:55054065-55054087 TGAGGTCCCCGGTTCCTTCCTGG + Intergenic
1175364477 20:58442833-58442855 TGTGGTCCCCAGGACCTACTAGG + Intronic
1175669875 20:60892948-60892970 TGGGGTCTCCAGGCATTTCTGGG - Intergenic
1179112772 21:38461603-38461625 TGGGGACCCCAGGGGGTTCCTGG - Intronic
1179180530 21:39041008-39041030 GGGAGTCCCCAGACCCTTTCAGG + Intergenic
1179540016 21:42078141-42078163 TGGGGTCAGCTGGCCCTGCCTGG - Intronic
1179540159 21:42078741-42078763 TGGGGTCAGCTGGCCCTGCCTGG - Intronic
1179961319 21:44768315-44768337 TGGGGTCCCCAAGACCACCCAGG - Intergenic
1179993494 21:44960677-44960699 TGGTGTCCCCAGACCCTTTCAGG + Intronic
1180998833 22:19978518-19978540 TGGGGTCAGCAGGGCCTCCCAGG + Intronic
1181048199 22:20226540-20226562 TGGGGACCCCAGGCCAGGCCTGG + Intergenic
1181306933 22:21922463-21922485 TGGGCCCACCAGGGCCTTCCGGG - Exonic
1181695607 22:24591428-24591450 TGGGGTCTAGAGGCCCCTCCTGG - Intronic
1183050561 22:35257665-35257687 GGGGTGCCCCAGGCCCTTCGCGG + Intronic
1183429077 22:37755012-37755034 AGGCCACCCCAGGCCCTTCCGGG - Intronic
1183664450 22:39239374-39239396 TGGGCTTACAAGGCCCTTCCGGG + Intronic
1184060274 22:42077370-42077392 TGGGGTCCCTGGGCCCCCCCAGG - Exonic
1184263517 22:43333339-43333361 AGGGGGCCCCAGGCCACTCCTGG + Intronic
1184296597 22:43529040-43529062 TGTGTCCCCCAGCCCCTTCCTGG - Intronic
1184297385 22:43533503-43533525 TGGGGTCTCCAGACCCTTATAGG + Intronic
1184383393 22:44160546-44160568 AGCGGTCCCCAGGCCTCTCCGGG + Intronic
1184411918 22:44330950-44330972 TGGGACCCCCAGGCCCCTCTGGG + Intergenic
1184498787 22:44859709-44859731 AGGGAGCCCCATGCCCTTCCAGG + Exonic
1184500038 22:44865895-44865917 AGGGAGCCCCATGCCCTTCCAGG - Intergenic
1184773151 22:46609754-46609776 TGGGGCCCCACGGCCCTCCCCGG - Intronic
1185106321 22:48871840-48871862 TGGGGGCCTCAGGCTCTTCCTGG + Intergenic
1185266519 22:49906964-49906986 TGCCCTCCCCAGGCCCTGCCAGG + Intronic
950154146 3:10709169-10709191 GGGTGTCTCCAGGCCCTTCTTGG + Intergenic
950510921 3:13426062-13426084 TGTGGTCCCCAGGCCCTCCGAGG + Intergenic
950742028 3:15059633-15059655 AGGGGTCCCCACGCCATTCAGGG - Intronic
952430113 3:33214822-33214844 TGAGGTCCCCAGGAGCCTCCTGG + Intronic
952898382 3:38094293-38094315 TGGGGTCCCCAGGGCAGCCCTGG - Intronic
952968560 3:38636617-38636639 TGGGGCCCCCAGGCTGCTCCTGG + Intronic
953042473 3:39267519-39267541 TGGGCTGCCCAGGACTTTCCTGG + Intronic
953641327 3:44711048-44711070 TGGGGTCCCCAGGCTCAGTCCGG - Intergenic
954450311 3:50567936-50567958 GTGGGTGGCCAGGCCCTTCCGGG + Intronic
954693606 3:52409151-52409173 TGGGGTGACAAGGCCCCTCCTGG - Intronic
955452009 3:59078599-59078621 TGGAGTCCTCAGTCCCTTGCTGG - Intergenic
960326332 3:116300462-116300484 AGGGGTCCCCAGCCCCATACTGG + Intronic
961446472 3:126983729-126983751 TGCGGTGTCCAGGCCCGTCCCGG + Intergenic
961726201 3:128932654-128932676 TGGGGTTCCCAGGCCTCACCTGG - Intronic
962235804 3:133706123-133706145 TGGAAACCCCAGGCCCTTCCTGG + Intergenic
962288028 3:134104959-134104981 TAGGCTGCCCTGGCCCTTCCTGG - Intronic
963160968 3:142149947-142149969 TTCGGTCCCCAGGCCTTTGCGGG + Intergenic
963851945 3:150217967-150217989 TGGGGACCTCAGGCCCTGGCTGG - Intergenic
964647834 3:158977549-158977571 TGGTCTCCCCAGGCCCCTCAGGG - Intronic
968377116 4:53133-53155 TGGGGCCTCCAGGCCCTTTCAGG - Intergenic
968454375 4:689491-689513 TGGGGTCCACAGCCCCCTTCAGG - Intergenic
968519250 4:1028318-1028340 TGGGGTCCCCCTGCCCAGCCTGG - Intergenic
968660191 4:1795661-1795683 TGGCCACCCCAGGCCCTGCCAGG + Intronic
968688678 4:1978447-1978469 TGGAGTCAACAGGCCCTGCCAGG + Intronic
968745894 4:2359924-2359946 GGGGGTCCCCAGGGTCTTTCAGG - Intronic
968954333 4:3710588-3710610 TGGGCTTGCCAGGCCCTTCCCGG + Intergenic
969240562 4:5894351-5894373 TAGGGTCCCCAGGGACTTGCAGG - Intergenic
969336893 4:6516271-6516293 TGGGGGCTCCAGGACCATCCTGG + Intronic
969466724 4:7361692-7361714 TGGGGTCCCCAGCCCTTCCCCGG - Intronic
969576297 4:8038001-8038023 TGGGCTCCCCAGGAGCTGCCGGG + Intronic
973872499 4:55180337-55180359 TGGAGAACCCAGGACCTTCCAGG + Intergenic
975689319 4:76949289-76949311 GGTGGTCCGCAGCCCCTTCCAGG + Intergenic
979335307 4:119455159-119455181 GGGGGTCCCCGGGCCCTGCCTGG - Intergenic
979980646 4:127250462-127250484 TTGGGTCCCTAAGCTCTTCCAGG - Intergenic
980007464 4:127558891-127558913 TGGGGTCTCCAGGTCCTCGCTGG - Intergenic
982399033 4:154945391-154945413 TAGGGTGCCCAGGACCATCCAGG - Intergenic
985236463 4:187880699-187880721 TGAGGACCTCAGGCCCTTGCTGG + Intergenic
985490060 5:174108-174130 TGGGGGCCGCAGGGCCTGCCAGG + Intronic
985564616 5:609062-609084 TGGGGACCCCAGGCCTGTGCGGG + Intergenic
985579759 5:690407-690429 TGGGGCCCCCAGGCCAGTGCTGG - Intronic
985594605 5:782466-782488 TGGGGCCCCCAGGCCAGTGCTGG - Intergenic
985638987 5:1054387-1054409 TGAGGTGCTCAGGCCCTTGCGGG + Intronic
985686148 5:1282775-1282797 TGAGGTCGCCAGGCCCTTGGTGG - Intronic
985686362 5:1283695-1283717 TGAGGTCGCCAGGCCCTTGGTGG - Intronic
985858576 5:2450654-2450676 TGGGGACCCCAAGACCTCCCTGG + Intergenic
988381645 5:30504337-30504359 GGGAGTCTCCAGGCCATTCCAGG + Intergenic
989812604 5:45695968-45695990 CGGGGTGCCCAGGCGCTTCTCGG + Exonic
991090544 5:62689995-62690017 CGGAGTCCCCATGCCCTCCCGGG - Intergenic
995371920 5:111427791-111427813 TGAGGTCCCCAGGCCCCCGCTGG - Intronic
995724742 5:115170527-115170549 TGGGGTTCCCTGGCCCCGCCCGG + Intronic
997646815 5:135487444-135487466 TGGGGTCCCCAGGCTGCTCCAGG - Intergenic
997965626 5:138353370-138353392 TGTGGTCCCCAGCCTCTCCCAGG + Intronic
1000216156 5:159158723-159158745 TGGGGTCAAAAGCCCCTTCCTGG + Exonic
1001317671 5:170655937-170655959 TTGGGGCCCAAGGCCTTTCCAGG - Intronic
1002052895 5:176581599-176581621 GGAGGCCCCCAGGCCCATCCTGG - Intronic
1002092518 5:176813526-176813548 TGGGGCCCCTAGGTCCTCCCAGG + Intronic
1002611719 5:180423792-180423814 TGGTGGCCCCAGGCCTTCCCTGG + Intergenic
1002660475 5:180788145-180788167 TGGTATCCACAGGCGCTTCCGGG + Intergenic
1005900672 6:30214112-30214134 TGGGTTCCCCAGGTCCTTGGTGG + Intergenic
1006295589 6:33168686-33168708 TGGGGTCACCAGGCACTCACAGG + Exonic
1006426283 6:33965074-33965096 TGGAGGCTCCAGGTCCTTCCAGG - Intergenic
1006518075 6:34555671-34555693 GGGGGACCCCAGGCCTTGCCGGG + Intronic
1006571873 6:35012368-35012390 GAGGGTCACCAGGCTCTTCCTGG - Intronic
1006603721 6:35242317-35242339 TGGGGTCCCCAGTCCAAACCTGG - Exonic
1007133180 6:39495919-39495941 TGGGGTCCCCAGGCCCCTGAAGG - Intronic
1007837112 6:44682321-44682343 TGAGGTTCCCAGACCTTTCCAGG + Intergenic
1008608035 6:53159227-53159249 GGGGCTCCCCAGACCCTTGCAGG - Intergenic
1011493652 6:87917504-87917526 TGGCTTCCCCAGGACCTTCCTGG - Intergenic
1013317444 6:108956163-108956185 TCTGGTCCTCAGGCCCTTCCTGG - Intronic
1013635733 6:112027510-112027532 TGGTGTGCCCAGGCTCTCCCTGG - Intergenic
1014505226 6:122247311-122247333 TGGGGTCCCCAAGCCAGACCTGG - Intergenic
1015502894 6:133952284-133952306 CGGGGTCCCCCGGCCCCTGCAGG + Intronic
1016185656 6:141195488-141195510 TGAGGTCTCCAGGCCCTGCATGG + Intergenic
1016521799 6:144954536-144954558 TGGGGGCCCCATGCCATTCGGGG + Intergenic
1017116101 6:150978442-150978464 TGTGTTCCCCAGGTGCTTCCTGG + Intronic
1018714760 6:166523426-166523448 TGGGGTCCCCAGGCCTCCCTGGG - Intronic
1018929570 6:168231935-168231957 TGGGGTCCCGAGGCCCCTTCAGG - Intergenic
1019087191 6:169489707-169489729 TACGGTGCCCAGGCCCATCCTGG - Intronic
1019295986 7:275627-275649 GGGGGTCCTCAGGGGCTTCCAGG - Intergenic
1019409773 7:901414-901436 TGGGGCTCCCTGGCTCTTCCTGG - Intronic
1019430465 7:996668-996690 TGCGGTCACCACGGCCTTCCCGG + Intergenic
1019518458 7:1449967-1449989 TAGGGTCCCCAGCCACCTCCTGG + Intronic
1019577065 7:1742666-1742688 TGGCGTCCCCTGGCCACTCCAGG + Intronic
1019686965 7:2387319-2387341 TGGGGTCCCCAAGATCCTCCCGG + Intergenic
1019706052 7:2497867-2497889 CAGGGTCCCCAGACCCTGCCGGG + Intergenic
1020080586 7:5283850-5283872 TCGGTTCCCCTGGTCCTTCCTGG + Intronic
1021292998 7:18868937-18868959 TGGAGTCTCCATGCCCTCCCTGG - Intronic
1022088558 7:27092591-27092613 TGGGCTCCACAGGTACTTCCAGG - Intergenic
1022969732 7:35505880-35505902 TGGCCTCTCCAGGCCTTTCCTGG - Intergenic
1023539989 7:41254696-41254718 TGGAATCCCCAGTCCTTTCCTGG + Intergenic
1023873337 7:44274333-44274355 CAGGGCCCCCAGGACCTTCCAGG + Intronic
1023994521 7:45151182-45151204 AGGGGTCTCCGGGCCCTTCCTGG - Intergenic
1023999607 7:45181967-45181989 TGGGCTTCCCAGACCCTTCCTGG + Intronic
1024212167 7:47215550-47215572 TTGGGTACTCAGTCCCTTCCAGG - Intergenic
1025198338 7:56948330-56948352 TCGGTTCCCCTGGTCCTTCCTGG - Intergenic
1025673611 7:63628603-63628625 TCGGTTCCCCTGGTCCTTCCTGG + Intergenic
1025757272 7:64357033-64357055 TGGTGCCCACAGCCCCTTCCTGG - Intergenic
1026498466 7:70923051-70923073 TGGGGTCTCCTGGTCCATCCTGG + Intergenic
1026891545 7:73985610-73985632 TGGGCACCCCAGGGCCTGCCTGG - Intergenic
1029125726 7:98293992-98294014 TGGGCACCGAAGGCCCTTCCGGG + Intronic
1029174857 7:98657554-98657576 TGGTGGCCCCAGGCCATCCCTGG - Intergenic
1029183274 7:98720018-98720040 TGGGGTCTGCAGGCCCCACCAGG - Intergenic
1031485359 7:122317128-122317150 TGCTGTCCCCAGGCCCTCTCGGG + Intergenic
1032364603 7:131287411-131287433 TGGGGGCCCCAGGCCTTCCTTGG + Intronic
1034269710 7:149797647-149797669 CCGGGTCCCCAGGGGCTTCCCGG + Intergenic
1034859144 7:154581381-154581403 CAGGGTTCCCTGGCCCTTCCAGG - Intronic
1035250438 7:157593640-157593662 TGGAGCCCCAGGGCCCTTCCAGG - Intronic
1035456547 7:159013150-159013172 TGGGGGCCCCAGGCTCTGCTGGG + Intergenic
1035657195 8:1319154-1319176 TGGGGGCCCCAGGCACTGCAGGG - Intergenic
1036643990 8:10600983-10601005 TGGAGCACCCAGCCCCTTCCTGG - Intergenic
1036802477 8:11802769-11802791 TGCGGTCCCCAGGCGCTCACCGG - Exonic
1040293547 8:46137677-46137699 AGAAGTCCCCAGGACCTTCCCGG - Intergenic
1040415187 8:47189022-47189044 TGGGCTCCCTCGGCCCCTCCCGG - Intergenic
1041026603 8:53693182-53693204 TGAGCTGCCAAGGCCCTTCCAGG - Intergenic
1043622176 8:82207750-82207772 TGGGGTCTCCATGCCTTGCCTGG + Intergenic
1045847831 8:106658172-106658194 TGGGCTCACCAGGTCCCTCCGGG - Intronic
1046745241 8:117868978-117869000 TGGGGCCCCCAGGACCTCCCCGG + Intronic
1047906630 8:129479716-129479738 TGGCCTCCCCAGGACCTTCTTGG + Intergenic
1048392773 8:133983986-133984008 TGATGTCCACAGGCCATTCCTGG - Intergenic
1048984551 8:139728261-139728283 TGGGGTCACCGGGCCTGTCCTGG + Intergenic
1049576853 8:143393585-143393607 TTGGGTCCCCCTGCCCATCCTGG + Intergenic
1049596264 8:143484889-143484911 TGAGGTCACCACGCCTTTCCAGG - Intronic
1052733664 9:32318562-32318584 TGCTTTCCACAGGCCCTTCCAGG + Intergenic
1056781506 9:89554539-89554561 TGGGGACTTCAGGCCTTTCCTGG + Intergenic
1057023598 9:91719268-91719290 ATGTGTCCCCAGGCCCTTCATGG + Intronic
1057125667 9:92614150-92614172 TGGGCTCCCTAGGTCCTTCAGGG - Exonic
1057129041 9:92640571-92640593 TGGGGTCCTCATGCCCTGACTGG - Intronic
1057268166 9:93632295-93632317 TGGGACCCCCAGCCCCTGCCTGG + Intronic
1057521950 9:95767120-95767142 GGTGGACCCCAGTCCCTTCCAGG + Intergenic
1058114474 9:101069466-101069488 TGGGATGGCCAGGCCTTTCCAGG - Intronic
1060509601 9:124222350-124222372 TGGGTCCCTCAGGCCCTTGCTGG + Intergenic
1061539850 9:131272339-131272361 TGGGGACATCAGGCCCTCCCTGG + Intronic
1061792913 9:133067918-133067940 ATGGGTCCCCAGGCCTTCCCGGG - Intronic
1061854125 9:133432534-133432556 AGGGGCCACCAGGGCCTTCCAGG - Intronic
1062045878 9:134424262-134424284 ATGAGTCCCCAGGCCCTTCTAGG + Intronic
1062302585 9:135883475-135883497 TGGTGTCCCCAGGCACTACATGG - Intronic
1062337308 9:136077697-136077719 TGGGGTCCCCTCGCATTTCCCGG - Intronic
1062369964 9:136233409-136233431 TGGGGTCCTAAGGCCCTTTAGGG + Intronic
1062405133 9:136392636-136392658 TGGGCTCCCCTGGGCCCTCCCGG + Intronic
1062468642 9:136692461-136692483 TGGGCTCCGACGGCCCTTCCTGG - Intergenic
1062483126 9:136761763-136761785 TGGGTTCTCCAGGCCCTGCAGGG - Intronic
1062529625 9:136994191-136994213 TGGGGAGCCCTGGCCCTGCCTGG - Intergenic
1062627400 9:137449521-137449543 TGGGATCCCCAGGGCCGGCCAGG - Intronic
1203747959 Un_GL000218v1:54014-54036 TGGGGGCTCCAGGTCCTTGCTGG + Intergenic
1203572121 Un_KI270744v1:141113-141135 TGGGGCCTCCAGGCCCTTTCAGG + Intergenic
1185505357 X:629679-629701 CTGGGTCCCCAGGCCCCGCCGGG + Intronic
1186220692 X:7346028-7346050 TGTGGTCCCCAGGCAATCCCAGG + Intronic
1187231589 X:17428699-17428721 TGGGGTCCCCAGAGACTTTCTGG - Intronic
1188442198 X:30223558-30223580 GGGGATCCCCAGGCCCTGCCAGG + Intergenic
1190630553 X:52381431-52381453 TGGGGTTTCCAGGGGCTTCCAGG - Intergenic
1192173882 X:68874116-68874138 TGGAGTCCTCAGGCACTTTCAGG - Intergenic
1197559429 X:127999515-127999537 TGGAGTCCCCAGGATTTTCCAGG - Intergenic
1197770661 X:130087119-130087141 TGGTGGCCGCAGGCACTTCCAGG - Intronic
1198313124 X:135438886-135438908 TGGGGTCCGCAGGCGATGCCGGG - Intergenic
1199093106 X:143713708-143713730 TGGGGTACTCACTCCCTTCCAGG + Intronic
1200205298 X:154311215-154311237 TGGGGTGCCCCGGCCCTTGAAGG - Exonic
1201179811 Y:11333285-11333307 TGGGGTTCCCAGGCCGCCCCTGG - Intergenic
1201958925 Y:19657222-19657244 TGGGGTCCTCAGGATCCTCCTGG + Intergenic