ID: 937225188

View in Genome Browser
Species Human (GRCh38)
Location 2:120364722-120364744
Sequence ATGCTCTTTTTGAAGAATGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937225188_937225192 23 Left 937225188 2:120364722-120364744 CCGTCATTCTTCAAAAAGAGCAT No data
Right 937225192 2:120364768-120364790 GGACCCTTTCTCCTTATTGTTGG No data
937225188_937225191 2 Left 937225188 2:120364722-120364744 CCGTCATTCTTCAAAAAGAGCAT No data
Right 937225191 2:120364747-120364769 TGGTGGCTGTCTTTTAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937225188 Original CRISPR ATGCTCTTTTTGAAGAATGA CGG (reversed) Intergenic
No off target data available for this crispr