ID: 937226481

View in Genome Browser
Species Human (GRCh38)
Location 2:120373267-120373289
Sequence CTCTGGGGAGGGAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937226473_937226481 -5 Left 937226473 2:120373249-120373271 CCCAGTGCCTACGGTTCTCTCTG No data
Right 937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG No data
937226472_937226481 -4 Left 937226472 2:120373248-120373270 CCCCAGTGCCTACGGTTCTCTCT No data
Right 937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG No data
937226474_937226481 -6 Left 937226474 2:120373250-120373272 CCAGTGCCTACGGTTCTCTCTGG No data
Right 937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937226481 Original CRISPR CTCTGGGGAGGGAGAGAAGA AGG Intergenic
No off target data available for this crispr