ID: 937226805

View in Genome Browser
Species Human (GRCh38)
Location 2:120374980-120375002
Sequence TTGAGACAGCCCATCTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937226805_937226809 0 Left 937226805 2:120374980-120375002 CCAAGAGAGATGGGCTGTCTCAA No data
Right 937226809 2:120375003-120375025 GGGGTGTCCCACTCCTGTCCAGG No data
937226805_937226812 11 Left 937226805 2:120374980-120375002 CCAAGAGAGATGGGCTGTCTCAA No data
Right 937226812 2:120375014-120375036 CTCCTGTCCAGGCTGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937226805 Original CRISPR TTGAGACAGCCCATCTCTCT TGG (reversed) Intergenic
No off target data available for this crispr